Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6957Btlr/Mmmh
Stock Number:
045068-MU
Citation ID:
RRID:MMRRC_045068-MU
Other Names:
R6957 (G1)
Major Collection:

Strain Information

Adcy10
Name: adenylate cyclase 10
Synonyms: soluble adenylyl cyclase, sAC, 4930431D04Rik, Sacy
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 271639
Homologene: 10188
Mad1l1
Name: MAD1 mitotic arrest deficient 1-like 1
Synonyms: Mad1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17120
HGNC: HGNC:6762
Homologene: 74500
Mybl2
Name: myeloblastosis oncogene-like 2
Synonyms: Bmyb, B-Myb
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17865
HGNC: HGNC:7548
Homologene: 1847
Ascc3
Name: activating signal cointegrator 1 complex subunit 3
Synonyms: ASC1p200, B630009I04Rik, Helic1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 77987
VEGA: 10
Homologene: 4973
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Iars1
Name: isoleucyl-tRNA synthetase 1
Synonyms: E430001P04Rik, 2510016L12Rik, Iars
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105148
HGNC: HGNC:5330
Homologene: 5325
Kmt2a
Name: lysine (K)-specific methyltransferase 2A
Synonyms: trithorax Drosophila, HTRX1, ALL-1, All1, Cxxc7, Mll, Mll1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214162
HGNC: HGNC:7132
Homologene: 4338
Slc12a2
Name: solute carrier family 12, member 2
Synonyms: sodium/potassium/chloride cotransporters, mBSC2, Nkcc1, sy-ns
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 20496
VEGA: 18
Homologene: 20283
Rapgef1
Name: Rap guanine nucleotide exchange factor (GEF) 1
Synonyms: C3G, 4932418O06Rik, Grf2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 107746
HGNC: HGNC:4568
Homologene: 50501
Zwilch
Name: zwilch kinetochore protein
Synonyms: 2310031L18Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68014
Homologene: 32381
Tbc1d23
Name: TBC1 domain family, member 23
Synonyms: 4930451A13Rik, D030022P07Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67581
VEGA: 16
Homologene: 10126
Amt
Name: aminomethyltransferase
Synonyms: EG434437
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 434437
HGNC: HGNC:473
Homologene: 409
Atxn10
Name: ataxin 10
Synonyms: TEG-169, E46, Sca10, Tex169
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 54138
VEGA: 15
Homologene: 40858
Casp3
Name: caspase 3
Synonyms: CPP32, Apopain, Yama, Caspase-3, A830040C14Rik, CC3, mldy, AC-3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12367
HGNC: HGNC:1504
Homologene: 37912
Phka2
Name: phosphorylase kinase alpha 2
Synonyms: k, Phk, 6330505C01Rik
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 110094
HGNC: HGNC:8926
Homologene: 246
Pfas
Name: phosphoribosylformylglycinamidine synthase (FGAR amidotransferase)
Synonyms: 4432409B16Rik, Sofa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237823
HGNC: HGNC:8863
Homologene: 5970
Ern1
Name: endoplasmic reticulum to nucleus signalling 1
Synonyms: 9030414B18Rik, Ire1p, Ire1alpha, Ire1a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78943
HGNC: HGNC:3449
Homologene: 55580
AU021092
Name: expressed sequence AU021092
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239691
Homologene: 17587
Ddx20
Name: DEAD box helicase 20
Synonyms: GEMIN3, dp103, DEAD (Asp-Glu-Ala-Asp) box polypeptide 20
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 53975
HGNC: HGNC:2743
Homologene: 5214
Asxl3
Name: ASXL transcriptional regulator 3
Synonyms: LOC381127, D930044O18Rik, D430002O22Rik, C230079D11Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 211961
Homologene: 19371
Cd22
Name: CD22 antigen
Synonyms: Lyb-8, Lyb8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12483
HGNC: HGNC:1643
Homologene: 31052
Cep164
Name: centrosomal protein 164
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214552
Homologene: 51110
Sbk3
Name: SH3 domain binding kinase family, member 3
Synonyms: LOC381835, Gm1078
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381835
Homologene: 82595
Il12rb2
Name: interleukin 12 receptor, beta 2
Synonyms: IL-12RB2, Ifnm, A930027I18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16162
HGNC: HGNC:5972
Homologene: 1197
Dnah14
Name: dynein, axonemal, heavy chain 14
Synonyms: LOC381311, A230079K17Rik, Gm980, Dnahc14
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240960
HGNC: HGNC:2945
Homologene: 90078
Nckap1l
Name: NCK associated protein 1 like
Synonyms: 4930568P13Rik, Hem1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105855
VEGA: 15
HGNC: HGNC:4862
Homologene: 3901
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Nalcn
Name: sodium leak channel, non-selective
Synonyms: A530023G15Rik, Vgcnl1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 338370
VEGA: 14
Homologene: 21832
Synm
Name: synemin, intermediate filament protein
Synonyms: 4930412K21Rik, Synemin, Dmn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233335
Homologene: 9081
Nlrp12
Name: NLR family, pyrin domain containing 12
Synonyms: Nalp12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 378425
Homologene: 16972
Lrp4
Name: low density lipoprotein receptor-related protein 4
Synonyms: 6430526J12Rik, Megf7, mdig
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228357
HGNC: HGNC:6696
Homologene: 17964
Wdpcp
Name: WD repeat containing planar cell polarity effector
Synonyms: homoloc-13, AV249152
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216560
Homologene: 9299
Sfmbt1
Name: Scm-like with four mbt domains 1
Synonyms: Smr, 4930442N21Rik, 9330180L21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 54650
Homologene: 9472
Ccdc168
Name: coiled-coil domain containing 168
Synonyms: Gm8251
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 102636082
VEGA: 1
Homologene: 141149
Cadm2
Name: cell adhesion molecule 2
Synonyms: A830029E02Rik, Necl3, SynCAM2, Igsf4d, 2900078E11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239857
Homologene: 17705
Qng1
Name: Q-nucleotide N-glycosylase 1
Synonyms: 2210016F16Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 70153
Homologene: 13005
Pde4dip
Name: phosphodiesterase 4D interacting protein (myomegalin)
Synonyms: D3Bwg1078e, 4732458A06Rik, D130016K21Rik, 9430063L05Rik, Usmg4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 83679
Homologene: 66961
Abcb5
Name: ATP-binding cassette, sub-family B member 5
Synonyms: 9230106F14Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 77706
HGNC: HGNC:46
Homologene: 83488
Vars2
Name: valyl-tRNA synthetase 2, mitochondrial
Synonyms: 1190004I24Rik, Vars2l
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68915
Homologene: 57502
St8sia3
Name: ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3
Synonyms: ST8SiaIII, Siat8c
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 20451
Homologene: 8285
Lratd2
Name: LRAT domain containing 1
Synonyms: D330050I23Rik, Fam84b
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 399603
Homologene: 18379
Greb1l
Name: growth regulation by estrogen in breast cancer-like
Synonyms: mKIAA4095, AK220484
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 381157
Homologene: 73393
Spata31h1
Name: SPATA31 subfamily H member 1
Synonyms: 4932415D10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 102635990
VEGA: 10
Homologene: 82476
Parp9
Name: poly (ADP-ribose) polymerase family, member 9
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 80285
Homologene: 12720
Stmnd1
Name: stathmin domain containing 1
Synonyms: LOC380842, Gm1574
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 380842
VEGA: 13
Homologene: 54416
Vmn2r13
Name: vomeronasal 2, receptor 13
Synonyms: Gm4867
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231589
Homologene: 129606
Lipo4
Name: lipase, member O4
Synonyms: Gm6857
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 628236
Homologene: 103863
Cntnap5b
Name: contactin associated protein-like 5B
Synonyms: Caspr5-2, C230078M14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241175
Homologene: 104295
Mup5
Name: major urinary protein 5
Synonyms: Mup V
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17844
Homologene: 74304
Fam186a
Name: family with sequence similarity 186, member A
Synonyms: LOC380973, 1700030F18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72277
Lrit1
Name: leucine-rich repeat, immunoglobulin-like and transmembrane domains 1
Synonyms: Lrrc21
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239037
Homologene: 9215
Adam26a
Name: ADAM metallopeptidase domain 26A
Synonyms: Dtgn4, Adam26
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13525
Homologene: 128363
Alcam
Name: activated leukocyte cell adhesion molecule
Synonyms: DM-GRASP, CD166, MuSC, BEN, SC1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11658
HGNC: HGNC:400
Homologene: 1229
Itih4
Name: inter alpha-trypsin inhibitor, heavy chain 4
Synonyms: Itih-4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16427
HGNC: HGNC:6169
Homologene: 1670
Ccdc85a
Name: coiled-coil domain containing 85A
Synonyms: E030025D05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216613
Homologene: 65605
Msi1
Name: musashi RNA-binding protein 1
Synonyms: m-Msi-1, Musahi1, Msi1, Msi1h
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17690
HGNC: HGNC:7330
Homologene: 55657
Syne3
Name: spectrin repeat containing, nuclear envelope family member 3
Synonyms: nesprin-3beta, nesprin-3alpha, nesprin-3, 4831426I19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 212073
VEGA: 12
Homologene: 17625
Pex13
Name: peroxisomal biogenesis factor 13
Synonyms: 2610008O20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72129
HGNC: HGNC:8855
Homologene: 1967
Cela3a
Name: chymotrypsin-like elastase family, member 3A
Synonyms: Gm13011
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242711
Homologene: 129880
Nudt7
Name: nudix hydrolase 7
Synonyms: 1300007B24Rik, 2210404C19Rik, nudix (nucleoside diphosphate linked moiety X)-type motif 7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67528
HGNC: HGNC:8054
Homologene: 41564
Qsox2
Name: quiescin Q6 sulfhydryl oxidase 2
Synonyms: QSOX2, Qscn6l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227638
Homologene: 65608
Samm50
Name: SAMM50 sorting and assembly machinery component
Synonyms: 1110030L07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68653
VEGA: 15
Homologene: 41034
Or4b1
Name: olfactory receptor family 4 subfamily B member 1
Synonyms: GA_x6K02T2Q125-51584440-51583526, MOR227-1, Olfr1270
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258987
HGNC: HGNC:8290
Homologene: 133648
Acsm4
Name: acyl-CoA synthetase medium-chain family member 4
Synonyms: O-MACS, OMACS
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233801
Homologene: 72281
Gm3159
Name: predicted gene 3159
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100041139
Homologene: 115686
Gipr
Name: gastric inhibitory polypeptide receptor
Synonyms: LOC232937, LOC381853, glucose-dependent insulinotropic polypeptide receptor
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381853
HGNC: HGNC:4271
Homologene: 20081
Paqr3
Name: progestin and adipoQ receptor family member III
Synonyms: 6330415A20Rik, RKTG
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231474
Homologene: 71077
Tnfrsf4
Name: tumor necrosis factor receptor superfamily, member 4
Synonyms: CD134, ACT35, Ox40, Txgp1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22163
Homologene: 2496
Samd13
Name: sterile alpha motif domain containing 13
Synonyms: LOC381481
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75015
Mecr
Name: mitochondrial trans-2-enoyl-CoA reductase
Synonyms: Nrbf1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 26922
Homologene: 5362
2310009B15Rik
Name: RIKEN cDNA 2310009B15 gene
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69549
Homologene: 19923
Hacd1
Name: 3-hydroxyacyl-CoA dehydratase 1
Synonyms: Ptpla
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 30963
HGNC: HGNC:9639
Homologene: 69153
Fam181a
Name: family with sequence similarity 181, member A
Synonyms: EG544888
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100504156
Homologene: 34701
Sgo2b
Name: shugoshin 2B
Synonyms: Gm4975, Sgol2b
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244495
Homologene: 51867
Or8g29
Name: olfactory receptor family 8 subfamily G member 29
Synonyms: GA_x6K02T2PVTD-32987171-32986232, MOR171-43, Or8g29-ps1, Olfr947-ps1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 257924
VEGA: 9
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 44,057,207 bp
  • A to G, chromosome 1 at 100,274,472 bp
  • A to G, chromosome 1 at 138,852,119 bp
  • C to A, chromosome 1 at 165,564,285 bp
  • G to C, chromosome 1 at 181,785,175 bp
  • A to T, chromosome 2 at 14,044,853 bp
  • C to T, chromosome 2 at 26,217,642 bp
  • C to A, chromosome 2 at 29,733,698 bp
  • G to T, chromosome 2 at 90,149,150 bp
  • C to A, chromosome 2 at 91,487,042 bp
  • C to T, chromosome 2 at 163,072,808 bp
  • A to T, chromosome 3 at 97,824,333 bp
  • C to A, chromosome 3 at 105,684,310 bp
  • A to G, chromosome 3 at 146,662,669 bp
  • T to A, chromosome 4 at 61,833,036 bp
  • A to G, chromosome 4 at 131,861,861 bp
  • A to T, chromosome 4 at 137,408,130 bp
  • G to A, chromosome 4 at 156,016,168 bp
  • A to T, chromosome 5 at 97,108,251 bp
  • A to T, chromosome 5 at 109,156,887 bp
  • G to A, chromosome 5 at 115,445,424 bp
  • G to T, chromosome 5 at 140,065,817 bp
  • G to A, chromosome 6 at 67,292,652 bp
  • T to A, chromosome 7 at 3,222,486 bp
  • A to T, chromosome 7 at 4,967,523 bp
  • T to A, chromosome 7 at 19,164,604 bp
  • T to C, chromosome 7 at 30,867,574 bp
  • C to T, chromosome 7 at 67,736,100 bp
  • T to G, chromosome 7 at 119,711,399 bp
  • G to A, chromosome 8 at 15,117,741 bp
  • T to A, chromosome 8 at 43,568,903 bp
  • T to A, chromosome 8 at 46,634,273 bp
  • CCATCATCATCATCATCATCAT to CCATCATCATCATCATCAT, chromosome 8 at 63,931,455 bp
  • A to G, chromosome 8 at 114,133,645 bp
  • A to G, chromosome 9 at 39,289,281 bp
  • A to C, chromosome 9 at 44,820,022 bp
  • A to G, chromosome 9 at 45,772,280 bp
  • A to C, chromosome 9 at 64,162,562 bp
  • C to A, chromosome 9 at 108,299,833 bp
  • A to G, chromosome 10 at 50,728,182 bp
  • A to T, chromosome 10 at 82,293,786 bp
  • T to C, chromosome 11 at 21,721,154 bp
  • T to G, chromosome 11 at 23,655,628 bp
  • A to T, chromosome 11 at 28,392,944 bp
  • C to A, chromosome 11 at 68,993,883 bp
  • A to C, chromosome 11 at 106,403,539 bp
  • G to A, chromosome 12 at 103,316,514 bp
  • A to T, chromosome 12 at 104,954,302 bp
  • A to G, chromosome 12 at 118,907,535 bp
  • T to G, chromosome 13 at 46,273,899 bp
  • T to G, chromosome 13 at 49,722,161 bp
  • C to A, chromosome 13 at 58,381,961 bp
  • T to C, chromosome 13 at 81,567,490 bp
  • A to G, chromosome 14 at 4,398,530 bp
  • C to T, chromosome 14 at 30,787,589 bp
  • T to C, chromosome 14 at 30,892,603 bp
  • G to C, chromosome 14 at 37,060,095 bp
  • T to A, chromosome 14 at 47,667,353 bp
  • T to C, chromosome 14 at 123,507,554 bp
  • T to C, chromosome 15 at 60,823,085 bp
  • T to A, chromosome 15 at 76,186,214 bp
  • G to T, chromosome 15 at 84,198,649 bp
  • T to C, chromosome 15 at 85,336,498 bp
  • T to A, chromosome 15 at 99,946,476 bp
  • T to C, chromosome 15 at 103,491,511 bp
  • T to C, chromosome 16 at 5,212,153 bp
  • A to G, chromosome 16 at 35,948,346 bp
  • T to C, chromosome 16 at 52,276,894 bp
  • A to G, chromosome 16 at 57,208,323 bp
  • A to T, chromosome 16 at 66,812,838 bp
  • T to G, chromosome 17 at 35,667,075 bp
  • A to G, chromosome 17 at 74,579,491 bp
  • G to A, chromosome 18 at 10,558,786 bp
  • C to A, chromosome 18 at 22,522,091 bp
  • T to A, chromosome 18 at 57,910,272 bp
  • T to C, chromosome 18 at 64,271,782 bp
  • A to G, chromosome 19 at 33,499,367 bp
  • G to A, chromosome X at 160,533,048 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6957 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045068-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.