Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6957Btlr/Mmmh
Stock Number:
045068-MU
Citation ID:
RRID:MMRRC_045068-MU
Other Names:
R6957 (G1)
Major Collection:

Strain Information

Adcy10
Name: adenylate cyclase 10
Synonyms: soluble adenylyl cyclase, sAC, 4930431D04Rik, Sacy
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 271639
Homologene: 10188
Mad1l1
Name: MAD1 mitotic arrest deficient 1-like 1
Synonyms: Mad1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17120
HGNC: HGNC:6762
Homologene: 74500
Mybl2
Name: myeloblastosis oncogene-like 2
Synonyms: Bmyb, B-Myb
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17865
HGNC: HGNC:7548
Homologene: 1847
Ascc3
Name: activating signal cointegrator 1 complex subunit 3
Synonyms: ASC1p200, B630009I04Rik, Helic1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 77987
VEGA: 10
Homologene: 4973
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Iars1
Name: isoleucyl-tRNA synthetase 1
Synonyms: E430001P04Rik, 2510016L12Rik, Iars
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105148
HGNC: HGNC:5330
Homologene: 5325
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 44,057,207 bp
  • A to G, chromosome 1 at 100,274,472 bp
  • A to G, chromosome 1 at 138,852,119 bp
  • C to A, chromosome 1 at 165,564,285 bp
  • G to C, chromosome 1 at 181,785,175 bp
  • A to T, chromosome 2 at 14,044,853 bp
  • C to T, chromosome 2 at 26,217,642 bp
  • C to A, chromosome 2 at 29,733,698 bp
  • G to T, chromosome 2 at 90,149,150 bp
  • C to A, chromosome 2 at 91,487,042 bp
  • C to T, chromosome 2 at 163,072,808 bp
  • A to T, chromosome 3 at 97,824,333 bp
  • C to A, chromosome 3 at 105,684,310 bp
  • A to G, chromosome 3 at 146,662,669 bp
  • T to A, chromosome 4 at 61,833,036 bp
  • A to G, chromosome 4 at 131,861,861 bp
  • A to T, chromosome 4 at 137,408,130 bp
  • G to A, chromosome 4 at 156,016,168 bp
  • A to T, chromosome 5 at 97,108,251 bp
  • A to T, chromosome 5 at 109,156,887 bp
  • G to A, chromosome 5 at 115,445,424 bp
  • G to T, chromosome 5 at 140,065,817 bp
  • G to A, chromosome 6 at 67,292,652 bp
  • T to A, chromosome 7 at 3,222,486 bp
  • A to T, chromosome 7 at 4,967,523 bp
  • T to A, chromosome 7 at 19,164,604 bp
  • T to C, chromosome 7 at 30,867,574 bp
  • C to T, chromosome 7 at 67,736,100 bp
  • T to G, chromosome 7 at 119,711,399 bp
  • G to A, chromosome 8 at 15,117,741 bp
  • T to A, chromosome 8 at 43,568,903 bp
  • T to A, chromosome 8 at 46,634,273 bp
  • CCATCATCATCATCATCATCAT to CCATCATCATCATCATCAT, chromosome 8 at 63,931,455 bp
  • A to G, chromosome 8 at 114,133,645 bp
  • A to G, chromosome 9 at 39,289,281 bp
  • A to C, chromosome 9 at 44,820,022 bp
  • A to G, chromosome 9 at 45,772,280 bp
  • A to C, chromosome 9 at 64,162,562 bp
  • C to A, chromosome 9 at 108,299,833 bp
  • A to G, chromosome 10 at 50,728,182 bp
  • A to T, chromosome 10 at 82,293,786 bp
  • T to C, chromosome 11 at 21,721,154 bp
  • T to G, chromosome 11 at 23,655,628 bp
  • A to T, chromosome 11 at 28,392,944 bp
  • C to A, chromosome 11 at 68,993,883 bp
  • A to C, chromosome 11 at 106,403,539 bp
  • G to A, chromosome 12 at 103,316,514 bp
  • A to T, chromosome 12 at 104,954,302 bp
  • A to G, chromosome 12 at 118,907,535 bp
  • T to G, chromosome 13 at 46,273,899 bp
  • T to G, chromosome 13 at 49,722,161 bp
  • C to A, chromosome 13 at 58,381,961 bp
  • T to C, chromosome 13 at 81,567,490 bp
  • A to G, chromosome 14 at 4,398,530 bp
  • C to T, chromosome 14 at 30,787,589 bp
  • T to C, chromosome 14 at 30,892,603 bp
  • G to C, chromosome 14 at 37,060,095 bp
  • T to A, chromosome 14 at 47,667,353 bp
  • T to C, chromosome 14 at 123,507,554 bp
  • T to C, chromosome 15 at 60,823,085 bp
  • T to A, chromosome 15 at 76,186,214 bp
  • G to T, chromosome 15 at 84,198,649 bp
  • T to C, chromosome 15 at 85,336,498 bp
  • T to A, chromosome 15 at 99,946,476 bp
  • T to C, chromosome 15 at 103,491,511 bp
  • T to C, chromosome 16 at 5,212,153 bp
  • A to G, chromosome 16 at 35,948,346 bp
  • T to C, chromosome 16 at 52,276,894 bp
  • A to G, chromosome 16 at 57,208,323 bp
  • A to T, chromosome 16 at 66,812,838 bp
  • T to G, chromosome 17 at 35,667,075 bp
  • A to G, chromosome 17 at 74,579,491 bp
  • G to A, chromosome 18 at 10,558,786 bp
  • C to A, chromosome 18 at 22,522,091 bp
  • T to A, chromosome 18 at 57,910,272 bp
  • T to C, chromosome 18 at 64,271,782 bp
  • A to G, chromosome 19 at 33,499,367 bp
  • G to A, chromosome X at 160,533,048 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6957 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045068-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.