Strain Name:
C57BL/6J-MtgxR6997Btlr/Mmmh
Stock Number:
045103-MU
Citation ID:
RRID:MMRRC_045103-MU
Other Names:
R6997 (G1)
Major Collection:

Strain Information

Cadps
Name: Ca2+-dependent secretion activator
Synonyms: CAPS1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 27062
VEGA: 14
HGNC: HGNC:1426
Homologene: 2755
Vcan
Name: versican
Synonyms: PG-M, hdf, heart defect, 5430420N07Rik, DPEAAE, Cspg2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Mmp10
Name: matrix metallopeptidase 10
Synonyms: stromelysin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17384
VEGA: 9
HGNC: HGNC:7156
Homologene: 20546
Osbpl1a
Name: oxysterol binding protein-like 1A
Synonyms: LOC328902, G430090F17Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 64291
Homologene: 84746
Map1b
Name: microtubule-associated protein 1B
Synonyms: MAP5, Mtap-5, Mtap5, LC1, Mtap1b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17755
VEGA: 13
HGNC: HGNC:6836
Homologene: 38111
Zdbf2
Name: zinc finger, DBF-type containing 2
Synonyms: 9330107J05Rik, 4930431J08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73884
Homologene: 52868
Cyp11b2
Name: cytochrome P450, family 11, subfamily b, polypeptide 2
Synonyms: aldosterone synthase, Cyp11b-2, Cyp11b, steroid-11-beta-hydroxylase
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13072
Homologene: 128035
Map4
Name: microtubule-associated protein 4
Synonyms: MAP 4, Mtap4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17758
HGNC: HGNC:6862
Homologene: 1780
Eprs1
Name: glutamyl-prolyl-tRNA synthetase 1
Synonyms: 2410081F06Rik, Qprs, 3010002K18Rik, Eprs
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 107508
HGNC: HGNC:3418
Homologene: 5870
Rack1
Name: receptor for activated C kinase 1
Synonyms: p205, GB-like, Gnb2-rs1, Gnb2l1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14694
HGNC: HGNC:4399
Homologene: 4446
Lamb2
Name: laminin, beta 2
Synonyms: Lamb-2, Lams, npht
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 16779
HGNC: HGNC:6487
Homologene: 1723
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Ripk1
Name: receptor (TNFRSF)-interacting serine-threonine kinase 1
Synonyms: Rinp, Rip1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19766
Homologene: 2820
Pikfyve
Name: phosphoinositide kinase, FYVE type zinc finger containing
Synonyms: 5230400C17Rik, Pip5k3, PipkIII
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18711
Homologene: 32115
Sfxn5
Name: sideroflexin 5
Synonyms: C230001H08Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 94282
Homologene: 16936
Gja8
Name: gap junction protein, alpha 8
Synonyms: Cnx50, connexin 50, alpha 8 connexin, Cx50, Aey5, Lop10, dcm
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14616
HGNC: HGNC:4281
Homologene: 3857
Mrtfa
Name: myocardin related transcription factor A
Synonyms: Mal, Bsac, MRTF-A, Mkl1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223701
Homologene: 32487
Pxk
Name: PX domain containing serine/threonine kinase
Synonyms: C230080L11Rik, D14Ertd813e, MONaKA
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218699
VEGA: 14
Homologene: 9828
Sp2
Name: Sp2 transcription factor
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78912
Homologene: 2340
Flii
Name: flightless I actin binding protein
Synonyms: 3632430F08Rik, Fliih
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14248
HGNC: HGNC:3750
Homologene: 11092
Ebf3
Name: early B cell factor 3
Synonyms: O/E-2, Olf-1/EBF-like 2, 3110018A08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13593
Homologene: 56472
Cdh19
Name: cadherin 19, type 2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227485
HGNC: HGNC:1758
Homologene: 23286
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, Dnchc2, b2b414Clo, m407Asp, m152Asp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Rsrc1
Name: arginine/serine-rich coiled-coil 1
Synonyms: SRrp53, 1200013F24Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66880
Homologene: 41147
Usp37
Name: ubiquitin specific peptidase 37
Synonyms: 4932415L06Rik, C330008N13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 319651
Homologene: 10858
Caprin2
Name: caprin family member 2
Synonyms: Eeg1, C1qdc1, RNG140
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232560
Homologene: 11393
Wnt8b
Name: wingless-type MMTV integration site family, member 8B
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 22423
VEGA: 19
Homologene: 2550
Dock2
Name: dedicator of cyto-kinesis 2
Synonyms: MBC, CED-5, Hch
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 94176
HGNC: HGNC:2988
Homologene: 37984
Kcnv1
Name: potassium channel, subfamily V, member 1
Synonyms: 2700023A03Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67498
VEGA: 15
Homologene: 22811
Tnfrsf11b
Name: tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin)
Synonyms: osteoclastogenesis inhibitory factor, OCIF, OPG, Opg, TR1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18383
VEGA: 15
Homologene: 1912
Orm3
Name: orosomucoid 3
Synonyms: Agp-3, Orm-3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18407
Homologene: 130632
Myh13
Name: myosin, heavy polypeptide 13, skeletal muscle
Synonyms: extraocular myosin, EO Myosin, MyHC-eo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 544791
HGNC: HGNC:7571
Homologene: 55780
Scn7a
Name: sodium channel, voltage-gated, type VII, alpha
Synonyms: Nav2.3, NaG, Nav2, 1110034K09Rik, Scn6a, Nax
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20272
Homologene: 55706
Ermap
Name: erythroblast membrane-associated protein
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 27028
Homologene: 22782
Cnga4
Name: cyclic nucleotide gated channel alpha 4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233649
HGNC: HGNC:2152
Homologene: 13579
Myh1
Name: myosin, heavy polypeptide 1, skeletal muscle, adult
Synonyms: MyHC-IId/x, Myhs-f, Myhs-f2, Myhsf2, A530084A17Rik, MYHC-IIX, myosin heavy chain 2X, IId, IId/x
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17879
HGNC: HGNC:7567
Homologene: 133718
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: bl, E130113P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
Gpr158
Name: G protein-coupled receptor 158
Synonyms: 5330427M13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241263
Homologene: 19381
Myo3b
Name: myosin IIIB
Synonyms: A430065P19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329421
Homologene: 51393
Vmn2r18
Name: vomeronasal 2, receptor 18
Synonyms: EG632671
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 632671
Ninl
Name: ninein-like
Synonyms: LOC381388, LOC381387, 4930519N13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78177
Homologene: 57024
Coil
Name: coilin
Synonyms: p80-coilin, Cln80
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12812
HGNC: HGNC:2184
Homologene: 3413
Atxn1
Name: ataxin 1
Synonyms: Atx1, Sca1, 2900016G23Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20238
VEGA: 13
Homologene: 281
Vmn2r52
Name: vomeronasal 2, receptor 52
Synonyms: EG384534
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384534
Homologene: 129605
Msh5
Name: mutS homolog 5
Synonyms: G7, Mut5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17687
HGNC: HGNC:7328
Homologene: 8415
Slc5a4b
Name: solute carrier family 5 (neutral amino acid transporters, system A), member 4b
Synonyms: 2010104G07Rik, pSGLT2, SAAT1, SGLT3b
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64454
Homologene: 56968
Lamc2
Name: laminin, gamma 2
Synonyms: nicein, 100kDa
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16782
HGNC: HGNC:6493
Homologene: 4062
Usp45
Name: ubiquitin specific petidase 45
Synonyms: 3110003C05Rik, Gcap7, 4930550B20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77593
Homologene: 17674
Or51b17
Name: olfactory receptor family 51 subfamily B member 17
Synonyms: 5'[b]2, MOR1-2, GA_x6K02T2PBJ9-6648196-6649143, Olfr64
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18366
Homologene: 56593
Vmn2r60
Name: vomeronasal 2, receptor 60
Synonyms: Casr-rs3, EG637898, Gprc2a-rs3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 637898
Homologene: 129683
Tchh
Name: trichohyalin
Synonyms: AHF, Thh
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99681
Homologene: 136273
Or8b44
Name: olfactory receptor family 8 subfamily B member 44
Synonyms: GA_x6K02T2PVTD-32204729-32205661, MOR165-5, Olfr907
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258801
VEGA: 9
Homologene: 27268
Selplg
Name: selectin, platelet (p-selectin) ligand
Synonyms: Psgl-1, Psgl1, CD162
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20345
Homologene: 2261
Dsc1
Name: desmocollin 1
Synonyms: Dsc1b, Dsc1a
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13505
VEGA: 18
HGNC: HGNC:3035
Homologene: 22761
Zfp945
Name: zinc finger protein 945
Synonyms: C730040L01Rik, A630033E08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240041
Homologene: 133214
Adam3
Name: ADAM metallopeptidase domain 3
Synonyms: Taz83, tMDC, Cyrn1, ADAM3, Taz83
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11497
HGNC: HGNC:209
Homologene: 69052
Calcoco2
Name: calcium binding and coiled-coil domain 2
Synonyms: 2410154J16Rik, Ndp52l1, Ndp52
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76815
Cnga3
Name: cyclic nucleotide gated channel alpha 3
Synonyms: CNG3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12790
HGNC: HGNC:2150
Homologene: 994
Map2k7
Name: mitogen-activated protein kinase kinase 7
Synonyms: MKK7, sek2, MAP kinase kinase 7, Jnkk2, Prkmk7, 5930412N11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 26400
HGNC: HGNC:6847
Homologene: 56548
Or4a79
Name: olfactory receptor family 4 subfamily A member 79
Synonyms: GA_x6K02T2Q125-51162884-51161940, MOR231-22_p, Olfr1252
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 404331
Homologene: 128094
Ccl8
Name: C-C motif chemokine ligand 8
Synonyms: MCP-2, 1810063B20Rik, Scya8, HC14
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20307
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 37,244,884 bp
  • T to G, chromosome 1 at 63,290,766 bp
  • T to A, chromosome 1 at 65,246,663 bp
  • A to G, chromosome 1 at 74,453,959 bp
  • T to C, chromosome 1 at 110,954,866 bp
  • G to A, chromosome 1 at 153,136,762 bp
  • A to G, chromosome 1 at 185,396,163 bp
  • C to T, chromosome 2 at 21,648,991 bp
  • A to T, chromosome 2 at 66,703,803 bp
  • A to T, chromosome 2 at 70,126,985 bp
  • G to A, chromosome 2 at 89,721,925 bp
  • G to T, chromosome 2 at 150,966,225 bp
  • C to T, chromosome 3 at 66,994,649 bp
  • CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC to CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC, chromosome 3 at 93,446,708 bp
  • A to G, chromosome 3 at 96,919,341 bp
  • G to T, chromosome 4 at 21,781,844 bp
  • T to A, chromosome 4 at 63,356,943 bp
  • A to T, chromosome 4 at 119,178,613 bp
  • C to T, chromosome 5 at 96,614,873 bp
  • GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT, chromosome 5 at 113,819,695 bp
  • T to A, chromosome 5 at 151,561,873 bp
  • A to G, chromosome 6 at 85,256,432 bp
  • A to G, chromosome 6 at 148,877,976 bp
  • C to T, chromosome 7 at 10,169,071 bp
  • C to A, chromosome 7 at 42,142,292 bp
  • A to T, chromosome 7 at 103,893,031 bp
  • A to T, chromosome 7 at 105,406,983 bp
  • A to C, chromosome 7 at 137,225,265 bp
  • T to C, chromosome 8 at 4,244,035 bp
  • T to C, chromosome 8 at 24,681,523 bp
  • A to T, chromosome 9 at 7,168,743 bp
  • A to G, chromosome 9 at 7,503,530 bp
  • T to C, chromosome 9 at 38,499,311 bp
  • T to C, chromosome 9 at 108,481,297 bp
  • T to A, chromosome 9 at 110,052,914 bp
  • C to T, chromosome 10 at 76,089,978 bp
  • T to C, chromosome 11 at 34,464,922 bp
  • T to A, chromosome 11 at 48,803,925 bp
  • T to C, chromosome 11 at 60,722,325 bp
  • T to A, chromosome 11 at 67,220,637 bp
  • C to T, chromosome 11 at 67,327,154 bp
  • A to T, chromosome 11 at 82,116,039 bp
  • A to G, chromosome 11 at 88,981,847 bp
  • GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC to GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC, chromosome 11 at 96,099,982 bp
  • C to T, chromosome 11 at 96,957,726 bp
  • G to T, chromosome 13 at 11,654,380 bp
  • C to T, chromosome 13 at 34,017,117 bp
  • C to T, chromosome 13 at 45,567,619 bp
  • T to C, chromosome 13 at 89,690,618 bp
  • T to C, chromosome 13 at 99,430,634 bp
  • A to T, chromosome 14 at 6,218,333 bp
  • T to A, chromosome 14 at 8,122,371 bp
  • T to A, chromosome 14 at 12,505,793 bp
  • A to T, chromosome 15 at 45,114,601 bp
  • G to A, chromosome 15 at 54,252,374 bp
  • A to G, chromosome 15 at 74,851,432 bp
  • G to T, chromosome 15 at 81,018,448 bp
  • T to A, chromosome 17 at 22,852,569 bp
  • A to T, chromosome 17 at 35,030,002 bp
  • T to C, chromosome 18 at 12,756,224 bp
  • C to T, chromosome 18 at 20,086,644 bp
  • G to A, chromosome 19 at 44,511,841 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6997 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045103-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.