Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7027Btlr/Mmmh
Stock Number:
045128-MU
Citation ID:
RRID:MMRRC_045128-MU
Other Names:
R7027 (G1)
Major Collection:

Strain Information

Grm1
Name: glutamate receptor, metabotropic 1
Synonyms: mGluR1, Grm1, Gprc1a, nmf373, rcw, 4930455H15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14816
HGNC: HGNC:4593
Homologene: 649
Slc26a5
Name: solute carrier family 26, member 5
Synonyms: Pres, prestin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80979
HGNC: HGNC:9359
Homologene: 69472
Adcy10
Name: adenylate cyclase 10
Synonyms: soluble adenylyl cyclase, sAC, 4930431D04Rik, Sacy
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 271639
Homologene: 10188
Agap1
Name: ArfGAP with GTPase domain, ankyrin repeat and PH domain 1
Synonyms: Ggap1, Centg2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 347722
Homologene: 56689
Fkbp5
Name: FK506 binding protein 5
Synonyms: FKBP51, Dit1, D17Ertd592e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14229
HGNC: HGNC:3721
Homologene: 3038
Nfya
Name: nuclear transcription factor-Y alpha
Synonyms: Sez10, Cbf-b
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18044
HGNC: HGNC:7804
Homologene: 32114
Fbxo31
Name: F-box protein 31
Synonyms: 2310046N15Rik, Fbx14, Fbxo14, 1110003O08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76454
Homologene: 11684
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 32,414,916 bp
  • T to A, chromosome 1 at 53,631,506 bp
  • A to G, chromosome 1 at 85,906,485 bp
  • A to G, chromosome 1 at 89,888,722 bp
  • A to G, chromosome 1 at 117,801,450 bp
  • A to G, chromosome 1 at 165,518,246 bp
  • G to A, chromosome 1 at 183,284,186 bp
  • T to C, chromosome 2 at 61,653,422 bp
  • A to G, chromosome 2 at 65,089,503 bp
  • A to G, chromosome 2 at 85,485,527 bp
  • A to G, chromosome 2 at 87,810,716 bp
  • A to G, chromosome 2 at 127,217,272 bp
  • A to T, chromosome 2 at 128,010,083 bp
  • T to G, chromosome 3 at 96,440,741 bp
  • A to G, chromosome 3 at 108,265,168 bp
  • T to C, chromosome 3 at 154,253,719 bp
  • G to A, chromosome 4 at 18,862,063 bp
  • A to G, chromosome 4 at 63,984,589 bp
  • A to G, chromosome 4 at 94,865,510 bp
  • T to C, chromosome 4 at 106,362,244 bp
  • G to A, chromosome 4 at 121,044,019 bp
  • A to G, chromosome 4 at 129,139,523 bp
  • G to A, chromosome 4 at 147,675,210 bp
  • A to G, chromosome 4 at 152,113,974 bp
  • A to T, chromosome 4 at 156,035,801 bp
  • C to T, chromosome 5 at 6,770,372 bp
  • T to A, chromosome 5 at 21,816,974 bp
  • T to C, chromosome 5 at 115,616,546 bp
  • C to A, chromosome 5 at 136,181,413 bp
  • C to T, chromosome 5 at 140,425,288 bp
  • T to A, chromosome 5 at 142,096,726 bp
  • T to A, chromosome 6 at 57,404,490 bp
  • T to G, chromosome 6 at 135,116,648 bp
  • T to A, chromosome 7 at 10,047,612 bp
  • A to G, chromosome 7 at 35,612,526 bp
  • A to G, chromosome 7 at 45,354,736 bp
  • A to T, chromosome 7 at 100,022,033 bp
  • A to C, chromosome 7 at 101,511,597 bp
  • T to A, chromosome 7 at 104,265,668 bp
  • A to T, chromosome 7 at 108,368,350 bp
  • A to G, chromosome 7 at 126,410,499 bp
  • A to G, chromosome 7 at 128,182,989 bp
  • A to G, chromosome 8 at 45,310,252 bp
  • T to C, chromosome 8 at 80,736,726 bp
  • T to C, chromosome 8 at 121,578,485 bp
  • T to A, chromosome 9 at 53,569,916 bp
  • T to C, chromosome 9 at 106,067,014 bp
  • T to C, chromosome 9 at 111,055,885 bp
  • T to C, chromosome 9 at 115,223,698 bp
  • A to T, chromosome 9 at 119,231,215 bp
  • A to G, chromosome 10 at 10,719,595 bp
  • G to T, chromosome 10 at 14,149,577 bp
  • G to T, chromosome 10 at 14,149,578 bp
  • G to A, chromosome 10 at 75,932,396 bp
  • G to A, chromosome 10 at 80,333,965 bp
  • C to G, chromosome 10 at 89,645,461 bp
  • C to T, chromosome 10 at 129,945,172 bp
  • A to G, chromosome 11 at 3,999,002 bp
  • A to T, chromosome 11 at 17,208,880 bp
  • C to A, chromosome 11 at 30,950,790 bp
  • T to C, chromosome 11 at 55,269,433 bp
  • G to A, chromosome 11 at 55,281,851 bp
  • C to A, chromosome 11 at 58,968,616 bp
  • C to T, chromosome 11 at 59,795,806 bp
  • T to A, chromosome 11 at 69,685,132 bp
  • T to A, chromosome 11 at 94,514,614 bp
  • T to A, chromosome 11 at 117,733,618 bp
  • T to C, chromosome 12 at 81,730,624 bp
  • CTCTTCTTCTTCACCATCTTCCTCCTCCTCCCCTTCTTCTTCTTCACCATCTTCCTCCTCCTCCCCTTCTTCTTCTTCACCATCTTCCTCCTCCTC to CTCTTCTTCTTCACCATCTTCCTCCTCCTCCCCTTCTTCTTCTTCACCATCTTCCTCCTCCTC, chromosome 12 at 109,591,414 bp
  • C to T, chromosome 13 at 40,733,674 bp
  • T to C, chromosome 13 at 60,176,233 bp
  • T to A, chromosome 15 at 27,805,654 bp
  • T to A, chromosome 16 at 19,769,990 bp
  • T to C, chromosome 16 at 22,892,257 bp
  • C to A, chromosome 16 at 31,989,295 bp
  • G to A, chromosome 16 at 87,719,291 bp
  • A to T, chromosome 17 at 13,225,779 bp
  • C to A, chromosome 17 at 18,313,286 bp
  • A to G, chromosome 17 at 28,412,063 bp
  • G to A, chromosome 17 at 37,752,409 bp
  • T to C, chromosome 17 at 48,389,312 bp
  • T to C, chromosome 18 at 21,129,994 bp
  • T to A, chromosome 18 at 32,841,905 bp
  • T to G, chromosome 18 at 34,312,076 bp
  • A to G, chromosome 18 at 37,721,362 bp
  • T to C, chromosome 18 at 37,727,111 bp
  • T to C, chromosome 19 at 6,141,089 bp
  • T to C, chromosome 19 at 16,664,664 bp
  • A to G, chromosome 19 at 20,940,903 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7027 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045128-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.