Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7028Btlr/Mmmh
Stock Number:
045129-MU
Citation ID:
RRID:MMRRC_045129-MU
Other Names:
R7028 (G1)
Major Collection:

Strain Information

Kif3a
Name: kinesin family member 3A
Synonyms: kinesin-II subunit, Kns3, Kif3, Kifl, N-4 kinesin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16568
HGNC: HGNC:6319
Homologene: 38266
Notch2
Name: notch 2
Synonyms: Motch B, N2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18129
HGNC: HGNC:7882
Homologene: 7865
Plg
Name: plasminogen
Synonyms: Pg
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18815
VEGA: 17
HGNC: HGNC:9071
Homologene: 55452
Mdm4
Name: transformed mouse 3T3 cell double minute 4
Synonyms: Mdmx, 4933417N07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17248
HGNC: HGNC:6974
Homologene: 1794
Tesk2
Name: testis-specific kinase 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230661
Homologene: 5188
Zfat
Name: zinc finger and AT hook domain containing
Synonyms: LOC380993, Zfp406, Zfat1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 380993
Homologene: 16829
Virma
Name: vir like m6A methyltransferase associated
Synonyms: 1110037F02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66185
Homologene: 41043
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 87,126,778 bp
  • A to T, chromosome 1 at 133,003,809 bp
  • C to T, chromosome 1 at 139,831,063 bp
  • A to G, chromosome 1 at 166,303,529 bp
  • G to A, chromosome 2 at 29,509,434 bp
  • T to A, chromosome 2 at 32,034,156 bp
  • T to A, chromosome 2 at 41,246,011 bp
  • T to C, chromosome 2 at 60,458,393 bp
  • A to G, chromosome 2 at 69,265,675 bp
  • A to T, chromosome 2 at 75,976,269 bp
  • T to G, chromosome 2 at 120,170,195 bp
  • T to C, chromosome 2 at 153,400,107 bp
  • T to C, chromosome 2 at 158,531,374 bp
  • A to T, chromosome 3 at 96,683,334 bp
  • T to A, chromosome 3 at 98,102,387 bp
  • C to T, chromosome 4 at 11,519,249 bp
  • C to A, chromosome 4 at 12,075,484 bp
  • C to A, chromosome 4 at 113,940,839 bp
  • G to A, chromosome 4 at 116,802,687 bp
  • G to A, chromosome 4 at 127,195,517 bp
  • A to G, chromosome 4 at 128,277,228 bp
  • T to A, chromosome 4 at 136,632,975 bp
  • A to T, chromosome 5 at 8,805,441 bp
  • A to G, chromosome 5 at 14,713,447 bp
  • A to G, chromosome 5 at 34,301,519 bp
  • A to G, chromosome 5 at 76,616,848 bp
  • G to A, chromosome 6 at 21,216,178 bp
  • G to A, chromosome 6 at 42,744,403 bp
  • G to T, chromosome 6 at 92,909,793 bp
  • A to T, chromosome 6 at 113,329,276 bp
  • C to G, chromosome 7 at 5,328,572 bp
  • T to A, chromosome 7 at 27,239,868 bp
  • T to C, chromosome 7 at 102,927,942 bp
  • T to G, chromosome 8 at 71,562,793 bp
  • G to T, chromosome 8 at 78,506,657 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • A to T, chromosome 8 at 128,881,594 bp
  • T to C, chromosome 9 at 24,628,251 bp
  • T to C, chromosome 9 at 39,956,345 bp
  • A to G, chromosome 9 at 64,193,823 bp
  • G to A, chromosome 9 at 69,196,083 bp
  • C to A, chromosome 9 at 77,788,216 bp
  • C to T, chromosome 9 at 108,963,263 bp
  • T to A, chromosome 9 at 110,246,891 bp
  • A to G, chromosome 10 at 114,518,177 bp
  • T to C, chromosome 11 at 48,908,244 bp
  • G to T, chromosome 11 at 53,586,906 bp
  • A to G, chromosome 11 at 59,079,133 bp
  • A to G, chromosome 11 at 67,220,421 bp
  • A to T, chromosome 11 at 102,314,980 bp
  • C to T, chromosome 11 at 103,614,537 bp
  • C to T, chromosome 11 at 114,781,208 bp
  • T to C, chromosome 12 at 55,758,059 bp
  • A to G, chromosome 13 at 21,703,270 bp
  • A to T, chromosome 13 at 65,036,063 bp
  • A to T, chromosome 13 at 69,738,754 bp
  • T to C, chromosome 14 at 51,693,037 bp
  • A to G, chromosome 14 at 57,597,051 bp
  • A to C, chromosome 15 at 68,180,452 bp
  • T to C, chromosome 15 at 71,471,563 bp
  • T to G, chromosome 15 at 75,948,305 bp
  • A to T, chromosome 15 at 83,131,497 bp
  • A to T, chromosome 16 at 5,055,324 bp
  • A to T, chromosome 16 at 32,794,246 bp
  • G to A, chromosome 16 at 87,719,291 bp
  • A to T, chromosome 17 at 12,391,836 bp
  • A to G, chromosome 17 at 35,910,005 bp
  • G to T, chromosome 17 at 37,064,737 bp
  • A to G, chromosome 17 at 56,999,978 bp
  • G to T, chromosome 17 at 73,943,873 bp
  • G to A, chromosome 18 at 67,401,911 bp
  • T to C, chromosome 19 at 12,650,359 bp
  • A to G, chromosome 19 at 39,639,897 bp
  • G to A, chromosome 19 at 47,652,183 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7028 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045129-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.