Strain Name:
C57BL/6J-MtgxR7028Btlr/Mmmh
Stock Number:
045129-MU
Citation ID:
RRID:MMRRC_045129-MU
Other Names:
R7028 (G1)
Major Collection:

Strain Information

Kif3a
Name: kinesin family member 3A
Synonyms: kinesin-II subunit, Kns3, Kif3, Kifl, N-4 kinesin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16568
HGNC: HGNC:6319
Homologene: 38266
Notch2
Name: notch 2
Synonyms: Motch B, N2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18129
HGNC: HGNC:7882
Homologene: 7865
Plg
Name: plasminogen
Synonyms: Pg
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18815
VEGA: 17
HGNC: HGNC:9071
Homologene: 55452
Mdm4
Name: transformed mouse 3T3 cell double minute 4
Synonyms: Mdmx, 4933417N07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17248
HGNC: HGNC:6974
Homologene: 1794
Tesk2
Name: testis-specific kinase 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230661
Homologene: 5188
Zfat
Name: zinc finger and AT hook domain containing
Synonyms: LOC380993, Zfp406, Zfat1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 380993
Homologene: 16829
Virma
Name: vir like m6A methyltransferase associated
Synonyms: 1110037F02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66185
Homologene: 41043
Xpo4
Name: exportin 4
Synonyms: B430309A01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 57258
Homologene: 10733
Nup214
Name: nucleoporin 214
Synonyms: D2H9S46E, CAN
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227720
HGNC: HGNC:8064
Homologene: 38008
Med27
Name: mediator complex subunit 27
Synonyms: 1500015J03Rik, 2310042P07Rik, D2Ertd434e, Crsp8
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68975
HGNC: HGNC:2377
Homologene: 3152
Asxl1
Name: ASXL transcriptional regulator 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228790
Homologene: 9098
Xdh
Name: xanthine dehydrogenase
Synonyms: Xox-1, Xox1, Xor, xanthine oxidase, XO
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22436
VEGA: 17
Homologene: 324
Ralgapa1
Name: Ral GTPase activating protein, alpha subunit 1
Synonyms: 4930400K19Rik, 2310003F20Rik, Tulip1, Garnl1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56784
VEGA: 12
Homologene: 84805
Ubn1
Name: ubinuclein 1
Synonyms: 1110029L11Rik, 2610108L02Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 170644
VEGA: 16
Homologene: 9656
Poldip3
Name: polymerase (DNA-directed), delta interacting protein 3
Synonyms: PDIP46, 1110008P04Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 73826
Homologene: 13007
Ubtf
Name: upstream binding transcription factor, RNA polymerase I
Synonyms: UBF1, Tcfubf, UBF, A930005G04Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21429
Homologene: 7970
Cep135
Name: centrosomal protein 135
Synonyms: LOC381644, Cep4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381644
Homologene: 45709
Gabbr1
Name: gamma-aminobutyric acid type B receptor subunit 1
Synonyms: GABAbR1, GABAB1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 54393
HGNC: HGNC:4070
Homologene: 1132
Gclc
Name: glutamate-cysteine ligase, catalytic subunit
Synonyms: gamma GCS-HS, Glclc, GLCL-H, D9Wsu168e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14629
HGNC: HGNC:4311
Homologene: 1148
Rbmxl1
Name: RNA binding motif protein, X-linked like-1
Synonyms: hnRNP G, Hnrpg, Rbmxrt
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19656
Homologene: 84779
Dpy19l2
Name: dpy-19 like 2
Synonyms: 4932443J21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320752
VEGA: 9
Homologene: 77569
Bach1
Name: BTB and CNC homology 1, basic leucine zipper transcription factor 1
Synonyms: 6230421P05Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12013
HGNC: HGNC:935
Homologene: 916
Tubb6
Name: tubulin, beta 6 class V
Synonyms: 2310057H16Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67951
VEGA: 18
Homologene: 69414
Trhde
Name: TRH-degrading enzyme
Synonyms: 9330155P21Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237553
Homologene: 75007
Pla2g4e
Name: phospholipase A2, group IVE
Synonyms: 2310026J01Rik, Pla2epsilon
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329502
Homologene: 65339
Kcnd2
Name: potassium voltage-gated channel, Shal-related family, member 2
Synonyms: Kv4.2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16508
HGNC: HGNC:6238
Homologene: 40828
Spata31d1c
Name: spermatogenesis associated 31 subfamily D, member 1C
Synonyms: Fam75d1c, 4932441B19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238683
VEGA: 13
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Acz, Pico
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Ankrd35
Name: ankyrin repeat domain 35
Synonyms: 4732436F15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213121
Homologene: 16977
Col7a1
Name: collagen, type VII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12836
HGNC: HGNC:2214
Homologene: 73
Fam135b
Name: family with sequence similarity 135, member B
Synonyms: A830008O07Rik, 1700010C24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70363
VEGA: 15
Homologene: 66605
Ift70a2
Name: intraflagellar transport 70A2
Synonyms: OTTMUSG00000015167, Ttc30a2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 620631
Homologene: 44342
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Skint5
Name: selection and upkeep of intraepithelial T cells 5
Synonyms: OTTMUSG00000008560
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242627
Homologene: 135888
Nxnl1
Name: nucleoredoxin-like 1
Synonyms: RdCVF, A930031O08Rik, Txnl6
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234404
Homologene: 89165
Nlrp2
Name: NLR family, pyrin domain containing 2
Synonyms: PYPAF2, E330007A02Rik, Nalp2, Pan1, Nbs1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232827
Homologene: 56789
Abcb11
Name: ATP-binding cassette, sub-family B member 11
Synonyms: PFIC2, ABC16, PGY4, Lith1, sister of P-glycoprotein, Bsep
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27413
HGNC: HGNC:42
Homologene: 74509
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Lrrc37
Name: leucine rich repeat containing 37
Synonyms: LOC380730, Gm884
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380730
Homologene: 134511
Myh1
Name: myosin, heavy polypeptide 1, skeletal muscle, adult
Synonyms: MyHC-IId/x, Myhs-f, Myhs-f2, Myhsf2, A530084A17Rik, MYHC-IIX, myosin heavy chain 2X, IId, IId/x
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17879
HGNC: HGNC:7567
Homologene: 133718
Adamts9
Name: ADAM metallopeptidase with thrombospondin type 1 motif 9
Synonyms: 1810011L16Rik, E030027K14Rik, 8430403M15Rik, Mhdaund4, Gsfund3, UND3, Mhdaund3, UND4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101401
Homologene: 18821
Abcb1b
Name: ATP-binding cassette, sub-family B member 1B
Synonyms: Mdr1, Mdr1b, mdr, Pgy1, Pgy-1, Abcb1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18669
HGNC: HGNC:40
Homologene: 69084
Coq8b
Name: coenzyme Q8B
Synonyms: 0610012P18Rik, Adck4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76889
Homologene: 86731
Zfp623
Name: zinc finger protein 623
Synonyms: 2610029D06Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78834
VEGA: 15
Homologene: 15994
Ildr2
Name: immunoglobulin-like domain containing receptor 2
Synonyms: 3110063L10Rik, 2810478N18Rik, OTTMUSG00000021748, ENSMUSG00000040612, Dbsm1, D1Ertd471e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100039795
Homologene: 52388
Rora
Name: RAR-related orphan receptor alpha
Synonyms: Nr1f1, 9530021D13Rik, tmgc26
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19883
Homologene: 56594
Pla2r1
Name: phospholipase A2 receptor 1
Synonyms: PLA2-I receptor, M-type receptor, Pla2g1br
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18779
HGNC: HGNC:9042
Homologene: 32016
Cspg5
Name: chondroitin sulfate proteoglycan 5
Synonyms: NGC, neuroglycan C, CALEB
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 29873
HGNC: HGNC:2467
Homologene: 4795
Csmd2
Name: CUB and Sushi multiple domains 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329942
Homologene: 89034
Ube2ql1
Name: ubiquitin-conjugating enzyme E2Q family-like 1
Synonyms: 3110006E14Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76980
VEGA: 13
Homologene: 15975
Arhgap40
Name: Rho GTPase activating protein 40
Synonyms: Gm14203
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 545481
Homologene: 53500
Kif19a
Name: kinesin family member 19A
Synonyms: N-8 kinesin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 286942
Homologene: 17709
Col17a1
Name: collagen, type XVII, alpha 1
Synonyms: BPAg2, BP180, Bpag, Bpag2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12821
HGNC: HGNC:2194
Homologene: 7276
Ogg1
Name: 8-oxoguanine DNA-glycosylase 1
Synonyms: Mmh
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18294
HGNC: HGNC:8125
Homologene: 1909
Tmem67
Name: transmembrane protein 67
Synonyms: 5330408M12Rik, b2b1291.1Clo, b2b1163.1Clo
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329795
Homologene: 71886
Gm12185
Name: predicted gene 12185
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 620913
Homologene: 83188
Dlgap3
Name: DLG associated protein 3
Synonyms: PSD-95/SAP90-binding protein 3, SAP90/PSD 95 associated protein 3, DAP3, Sapap3, Prpl8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242667
Homologene: 18276
Map2k1
Name: mitogen-activated protein kinase kinase 1
Synonyms: MAP kinase kinase 1, Prkmk1, Mek1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 26395
HGNC: HGNC:6840
Homologene: 2063
Glyat
Name: glycine-N-acyltransferase
Synonyms: A330009E03Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107146
Homologene: 64840
Akp3
Name: alkaline phosphatase 3, intestine, not Mn requiring
Synonyms: IAP, Akp-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11648
Homologene: 134333
Ccdc7a
Name: coiled-coil domain containing 7A
Synonyms: 4930540C21Rik, 4930517G15Rik, Ccdc7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74703
Homologene: 134760
Cfhr2
Name: complement factor H-related 2
Synonyms: FHR-B
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545366
Homologene: 134349
Pspn
Name: persephin
Synonyms: PSP
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19197
HGNC: HGNC:9579
Homologene: 3065
Cyp2c67
Name: cytochrome P450, family 2, subfamily c, polypeptide 67
Synonyms: C730004C24Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 545288
Homologene: 74936
Or51h5
Name: olfactory receptor family 51 subfamily H member 5
Synonyms: GA_x6K02T2PBJ9-5638785-5639741, MOR10-2, Olfr572
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259093
Homologene: 131142
Atat1
Name: alpha tubulin acetyltransferase 1
Synonyms: 2610008K08Rik, 3110080J08Rik, 0610011P08Rik, 2610110G12Rik, MEC-17
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 73242
Homologene: 15129
Or2f1
Name: olfactory receptor family 2 subfamily F member 1
Synonyms: GA_x6K02T2P3E9-4815856-4814903, MOR257-8P, Olfr453
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258016
HGNC: HGNC:8246
Homologene: 128151
Or10d5j
Name: olfactory receptor family 10 subfamily D member 5J
Synonyms: GA_x6K02T2PVTD-33657378-33656440, MOR224-10, Olfr976
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258364
VEGA: 9
Homologene: 64863
Lactbl1
Name: lactamase, beta-like 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242707
Homologene: 82492
Or2b2
Name: olfactory receptor family 2 subfamily B member 2
Synonyms: GA_x6K02T2QHY8-11534186-11533245, MOR256-60, MOR256-35, Olfr1359
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 258067
Homologene: 11056
Cmtm1
Name: CKLF-like MARVEL transmembrane domain containing 1
Synonyms: CHLFH1a, CKLFH1, Cklfsf1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100504164
Homologene: 134399
Gm17079
Name: predicted gene 17079
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 102640847
Homologene: 128452
Cfap99
Name: cilia and flagella associated protein 99
Synonyms: Gm21446
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100862066
Homologene: 82544
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 87,126,778 bp
  • A to T, chromosome 1 at 133,003,809 bp
  • C to T, chromosome 1 at 139,831,063 bp
  • A to G, chromosome 1 at 166,303,529 bp
  • G to A, chromosome 2 at 29,509,434 bp
  • T to A, chromosome 2 at 32,034,156 bp
  • T to A, chromosome 2 at 41,246,011 bp
  • T to C, chromosome 2 at 60,458,393 bp
  • A to G, chromosome 2 at 69,265,675 bp
  • A to T, chromosome 2 at 75,976,269 bp
  • T to G, chromosome 2 at 120,170,195 bp
  • T to C, chromosome 2 at 153,400,107 bp
  • T to C, chromosome 2 at 158,531,374 bp
  • A to T, chromosome 3 at 96,683,334 bp
  • T to A, chromosome 3 at 98,102,387 bp
  • C to T, chromosome 4 at 11,519,249 bp
  • C to A, chromosome 4 at 12,075,484 bp
  • C to A, chromosome 4 at 113,940,839 bp
  • G to A, chromosome 4 at 116,802,687 bp
  • G to A, chromosome 4 at 127,195,517 bp
  • A to G, chromosome 4 at 128,277,228 bp
  • T to A, chromosome 4 at 136,632,975 bp
  • A to T, chromosome 5 at 8,805,441 bp
  • A to G, chromosome 5 at 14,713,447 bp
  • A to G, chromosome 5 at 34,301,519 bp
  • A to G, chromosome 5 at 76,616,848 bp
  • G to A, chromosome 6 at 21,216,178 bp
  • G to A, chromosome 6 at 42,744,403 bp
  • G to T, chromosome 6 at 92,909,793 bp
  • A to T, chromosome 6 at 113,329,276 bp
  • C to G, chromosome 7 at 5,328,572 bp
  • T to A, chromosome 7 at 27,239,868 bp
  • T to C, chromosome 7 at 102,927,942 bp
  • T to G, chromosome 8 at 71,562,793 bp
  • G to T, chromosome 8 at 78,506,657 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • A to T, chromosome 8 at 128,881,594 bp
  • T to C, chromosome 9 at 24,628,251 bp
  • T to C, chromosome 9 at 39,956,345 bp
  • A to G, chromosome 9 at 64,193,823 bp
  • G to A, chromosome 9 at 69,196,083 bp
  • C to A, chromosome 9 at 77,788,216 bp
  • C to T, chromosome 9 at 108,963,263 bp
  • T to A, chromosome 9 at 110,246,891 bp
  • A to G, chromosome 10 at 114,518,177 bp
  • T to C, chromosome 11 at 48,908,244 bp
  • G to T, chromosome 11 at 53,586,906 bp
  • A to G, chromosome 11 at 59,079,133 bp
  • A to G, chromosome 11 at 67,220,421 bp
  • A to T, chromosome 11 at 102,314,980 bp
  • C to T, chromosome 11 at 103,614,537 bp
  • C to T, chromosome 11 at 114,781,208 bp
  • T to C, chromosome 12 at 55,758,059 bp
  • A to G, chromosome 13 at 21,703,270 bp
  • A to T, chromosome 13 at 65,036,063 bp
  • A to T, chromosome 13 at 69,738,754 bp
  • T to C, chromosome 14 at 51,693,037 bp
  • A to G, chromosome 14 at 57,597,051 bp
  • A to C, chromosome 15 at 68,180,452 bp
  • T to C, chromosome 15 at 71,471,563 bp
  • T to G, chromosome 15 at 75,948,305 bp
  • A to T, chromosome 15 at 83,131,497 bp
  • A to T, chromosome 16 at 5,055,324 bp
  • A to T, chromosome 16 at 32,794,246 bp
  • G to A, chromosome 16 at 87,719,291 bp
  • A to T, chromosome 17 at 12,391,836 bp
  • A to G, chromosome 17 at 35,910,005 bp
  • G to T, chromosome 17 at 37,064,737 bp
  • A to G, chromosome 17 at 56,999,978 bp
  • G to T, chromosome 17 at 73,943,873 bp
  • G to A, chromosome 18 at 67,401,911 bp
  • T to C, chromosome 19 at 12,650,359 bp
  • A to G, chromosome 19 at 39,639,897 bp
  • G to A, chromosome 19 at 47,652,183 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7028 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045129-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.