Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7037Btlr/Mmmh
Stock Number:
045137-MU
Citation ID:
RRID:MMRRC_045137-MU
Other Names:
R7037 (G1)
Major Collection:

Strain Information

Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Mc3r
Name: melanocortin 3 receptor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17201
HGNC: HGNC:6931
Homologene: 7412
Met
Name: met proto-oncogene
Synonyms: HGF receptor, c-Met, Par4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17295
HGNC: HGNC:7029
Homologene: 206
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Bicral
Name: BRD4 interacting chromatin remodeling complex associated protein like
Synonyms: BC032203, Gltscr1l
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210982
VEGA: 17
Homologene: 19366
Atp6v1h
Name: ATPase, H+ transporting, lysosomal V1 subunit H
Synonyms: 0710001F19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108664
Homologene: 7139
Eml4
Name: echinoderm microtubule associated protein like 4
Synonyms: 4930443C24Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78798
VEGA: 17
HGNC: HGNC:1316
Homologene: 56841
Usp19
Name: ubiquitin specific peptidase 19
Synonyms: 8430421I07Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71472
Homologene: 41730
Ptbp2
Name: polypyrimidine tract binding protein 2
Synonyms: brPTB
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56195
Homologene: 23162
Med25
Name: mediator complex subunit 25
Synonyms: ESTM2, 2610529E18Rik, 2610034E13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75613
Homologene: 12614
Smc4
Name: structural maintenance of chromosomes 4
Synonyms: 2500002A22Rik, Smc4l1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70099
Homologene: 4015
Coro1c
Name: coronin, actin binding protein 1C
Synonyms: coronin 3, CRN2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23790
HGNC: HGNC:2254
Homologene: 56537
Cpsf4
Name: cleavage and polyadenylation specific factor 4
Synonyms: 30kDa
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 54188
HGNC: HGNC:2327
Homologene: 38216
Utp25
Name: UTP25 small subunit processome component
Synonyms: AA408296, Diexf, mDef
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 215193
Homologene: 6170
Mmp16
Name: matrix metallopeptidase 16
Synonyms: Membrane type 3-MMP, MT3-MMP
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17389
HGNC: HGNC:7162
Homologene: 55939
Triml2
Name: tripartite motif family-like 2
Synonyms: EG622117
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 622117
Homologene: 18316
Kank1
Name: KN motif and ankyrin repeat domains 1
Synonyms: D330024H06Rik, A930031B09Rik, Ankrd15
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107351
Homologene: 17706
Gna14
Name: guanine nucleotide binding protein, alpha 14
Synonyms: G alpha 14
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14675
VEGA: 19
HGNC: HGNC:4382
Homologene: 68386
Kif13a
Name: kinesin family member 13A
Synonyms: N-3 kinesin, 4930505I07Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16553
VEGA: 13
Homologene: 22589
Pms1
Name: PMS1 homolog 1, mismatch repair system component
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227099
HGNC: HGNC:9121
Homologene: 449
Elac2
Name: elaC ribonuclease Z 2
Synonyms: 1110017O07Rik, D11Wsu80e, tRNase Z(L)
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68626
Homologene: 6403
Ints7
Name: integrator complex subunit 7
Synonyms: 5930412E23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 77065
Homologene: 9136
Dbr1
Name: debranching RNA lariats 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83703
Homologene: 9428
Baz2b
Name: bromodomain adjacent to zinc finger domain, 2B
Synonyms: D2Ertd794e, 5830435C13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 407823
HGNC: HGNC:963
Homologene: 8394
Pigt
Name: phosphatidylinositol glycan anchor biosynthesis, class T
Synonyms: CGI-06, 4930534E15Rik, Ndap7, NDAP, 2510012P17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78928
Homologene: 6134
Baiap3
Name: BAI1-associated protein 3
Synonyms: LOC381076
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 545192
HGNC: HGNC:948
Homologene: 20844
Scn4a
Name: sodium channel, voltage-gated, type IV, alpha
Synonyms: Nav1.4, mH2, SkM1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 110880
Homologene: 283
C1rl
Name: complement component 1, r subcomponent-like
Synonyms: C1r-LP, C1rl1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232371
Homologene: 9559
Dpyd
Name: dihydropyrimidine dehydrogenase
Synonyms: DPD, E330028L06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99586
HGNC: HGNC:3012
Homologene: 85
Itgb4
Name: integrin beta 4
Synonyms: CD104
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192897
HGNC: HGNC:6158
Homologene: 179
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Ahnak2
Name: AHNAK nucleoprotein 2
Synonyms: LOC382643
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100041194
Homologene: 131081
Sycp1
Name: synaptonemal complex protein 1
Synonyms: SCP1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20957
Homologene: 2389
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Tm7sf2
Name: transmembrane 7 superfamily member 2
Synonyms: ANG1, 3110041O18Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73166
Homologene: 68305
Dclk1
Name: doublecortin-like kinase 1
Synonyms: CPG16, DCLK, 1700113D08Rik, 2810480F11Rik, Dcl, Click-I, Dcamkl1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13175
HGNC: HGNC:2700
Homologene: 130530
Or2ag19
Name: olfactory receptor family 2 subfamily AG member 19
Synonyms: GA_x6K02T2PBJ9-9222217-9223176, MOR283-7, Olfr703
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258589
Plce1
Name: phospholipase C, epsilon 1
Synonyms: 4933403A21Rik, PLCepsilon
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 74055
Homologene: 9478
Rev3l
Name: REV3 like, DNA directed polymerase zeta catalytic subunit
Synonyms: Sez4, Rev
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19714
HGNC: HGNC:9968
Homologene: 48147
St18
Name: suppression of tumorigenicity 18
Synonyms: Nzf3, Myt3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240690
Homologene: 8792
Tmem241
Name: transmembrane protein 241
Synonyms: 6030446N20Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 338363
Homologene: 87267
Mus81
Name: MUS81 structure-specific endonuclease subunit
Synonyms: 1200008A18Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71711
Homologene: 5725
Lrrc66
Name: leucine rich repeat containing 66
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231296
Homologene: 51944
Siah3
Name: siah E3 ubiquitin protein ligase family member 3
Synonyms: LOC380918
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 380918
VEGA: 14
Homologene: 54375
Tex14
Name: testis expressed gene 14 intercellular bridge forming factor
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 83560
Homologene: 12838
Garin5b
Name: golgi associated RAB2 interactor family member 5B
Synonyms: 4930401F20Rik, Fam71e2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243822
Homologene: 89225
Cttnbp2
Name: cortactin binding protein 2
Synonyms: ORF4, Cortbp2, 9130022E09Rik, 4732477G22Rik, 3010022N24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 30785
Homologene: 14125
Sema5a
Name: sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A
Synonyms: M-Sema D, semF, Semaf, 9130201M22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20356
VEGA: 15
Homologene: 2949
Prex1
Name: phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1
Synonyms: P-REX1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 277360
Homologene: 10821
Foxred1
Name: FAD-dependent oxidoreductase domain containing 1
Synonyms: TEG-23, Tex23
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235169
Homologene: 9712
Scai
Name: suppressor of cancer cell invasion
Synonyms: A930041I02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320271
Homologene: 15523
Naaa
Name: N-acylethanolamine acid amidase
Synonyms: 2210023K21Rik, 3830414F09Rik, Asahl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67111
HGNC: HGNC:736
Homologene: 8686
Ccr9
Name: C-C motif chemokine receptor 9
Synonyms: GPR-9-6, Cmkbr10
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12769
HGNC: HGNC:1610
Homologene: 22546
Cryzl2
Name: crystallin zeta like 2
Synonyms: quinone reductase-like 2, BC026585
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226527
Homologene: 41713
Acsm3
Name: acyl-CoA synthetase medium-chain family member 3
Synonyms: Sa, Sah
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20216
Homologene: 74559
Mrgprb3
Name: MAS-related GPR, member B3
Synonyms: MrgB3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 404238
Homologene: 138632
H2-Ab1
Name: histocompatibility 2, class II antigen A, beta 1
Synonyms: A beta, Abeta, H-2Ab, Ia-2, Ia2, H2-Ab, IAb, I-Ab, I-Abeta, Rmcs1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14961
Homologene: 1603
Arl14epl
Name: ADP-ribosylation factor-like 14 effector protein-like
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 381142
VEGA: 18
Homologene: 85362
Pbx4
Name: pre B cell leukemia homeobox 4
Synonyms: 2410015M21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 80720
Homologene: 57027
Gask1a
Name: golgi associated kinase 1A
Synonyms: C730027P07Rik, Fam198a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245050
VEGA: 9
Homologene: 18620
Krtap4-22
Name: keratin associated protein 4-22
Synonyms: Gm11595
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 100040276
Homologene: 124486
Tomm34
Name: translocase of outer mitochondrial membrane 34
Synonyms: TOM34, 2610100K07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67145
Homologene: 4956
Rpl37
Name: ribosomal protein L37
Synonyms: 3110005M08Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67281
VEGA: 15
Homologene: 68110
Pals1
Name: protein associated with LIN7 1, MAGUK family member
Synonyms: Pals1, 3830420B02Rik, Mpp5
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56217
VEGA: 12
Homologene: 9512
Popdc2
Name: popeye domain containing 2
Synonyms: Pop2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 64082
Homologene: 11147
Tmem54
Name: transmembrane protein 54
Synonyms: 1810017F10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66260
Homologene: 11937
Spata31d1a
Name: spermatogenesis associated 31 subfamily D, member 1A
Synonyms: 1700013B16Rik, Fam75d3, Fam75d1a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72219
VEGA: 13
Homologene: 122131
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 5,149,992 bp
  • C to A, chromosome 1 at 6,803,036 bp
  • T to C, chromosome 1 at 53,207,611 bp
  • G to A, chromosome 1 at 157,470,748 bp
  • T to C, chromosome 1 at 191,619,605 bp
  • A to C, chromosome 1 at 193,120,723 bp
  • A to T, chromosome 2 at 39,190,621 bp
  • C to T, chromosome 2 at 59,933,670 bp
  • T to A, chromosome 2 at 112,949,130 bp
  • G to T, chromosome 2 at 150,266,456 bp
  • A to G, chromosome 2 at 164,070,478 bp
  • CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT to CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT, chromosome 2 at 164,499,669 bp
  • A to G, chromosome 2 at 166,587,180 bp
  • T to C, chromosome 2 at 172,249,634 bp
  • T to C, chromosome 3 at 55,463,048 bp
  • G to A, chromosome 3 at 69,018,195 bp
  • T to A, chromosome 3 at 102,898,934 bp
  • A to T, chromosome 3 at 118,899,289 bp
  • A to G, chromosome 3 at 119,751,908 bp
  • T to C, chromosome 4 at 18,116,148 bp
  • T to A, chromosome 4 at 129,110,801 bp
  • T to C, chromosome 5 at 30,381,538 bp
  • A to T, chromosome 5 at 73,607,161 bp
  • A to G, chromosome 5 at 92,277,075 bp
  • A to G, chromosome 5 at 113,845,396 bp
  • G to A, chromosome 5 at 145,176,129 bp
  • A to T, chromosome 6 at 17,547,128 bp
  • T to C, chromosome 6 at 18,435,118 bp
  • A to G, chromosome 6 at 124,508,639 bp
  • G to T, chromosome 7 at 4,758,585 bp
  • A to G, chromosome 7 at 44,882,782 bp
  • A to G, chromosome 7 at 48,643,194 bp
  • T to C, chromosome 7 at 106,845,336 bp
  • A to T, chromosome 7 at 119,768,043 bp
  • T to A, chromosome 8 at 43,193,536 bp
  • A to G, chromosome 8 at 69,864,875 bp
  • T to A, chromosome 8 at 104,617,635 bp
  • A to T, chromosome 9 at 35,207,548 bp
  • T to A, chromosome 9 at 99,576,568 bp
  • T to C, chromosome 9 at 108,496,958 bp
  • G to T, chromosome 9 at 121,965,526 bp
  • T to A, chromosome 9 at 123,779,971 bp
  • T to A, chromosome 10 at 12,826,770 bp
  • C to T, chromosome 10 at 39,851,975 bp
  • T to A, chromosome 11 at 59,043,929 bp
  • T to C, chromosome 11 at 59,052,604 bp
  • A to G, chromosome 11 at 64,983,711 bp
  • A to T, chromosome 11 at 87,497,915 bp
  • A to G, chromosome 11 at 99,772,648 bp
  • C to A, chromosome 11 at 106,320,900 bp
  • T to A, chromosome 11 at 116,005,565 bp
  • T to A, chromosome 12 at 78,797,199 bp
  • A to T, chromosome 12 at 112,774,278 bp
  • A to G, chromosome 13 at 13,616,666 bp
  • C to T, chromosome 13 at 46,752,455 bp
  • C to T, chromosome 13 at 59,700,324 bp
  • A to G, chromosome 14 at 75,525,585 bp
  • G to A, chromosome 15 at 5,117,703 bp
  • A to G, chromosome 15 at 32,686,847 bp
  • A to G, chromosome 16 at 38,374,267 bp
  • G to A, chromosome 17 at 25,243,840 bp
  • T to A, chromosome 17 at 34,267,989 bp
  • T to C, chromosome 17 at 46,824,634 bp
  • T to A, chromosome 17 at 83,425,327 bp
  • G to T, chromosome 18 at 12,113,406 bp
  • T to G, chromosome 18 at 46,932,443 bp
  • A to G, chromosome 19 at 5,486,080 bp
  • A to T, chromosome 19 at 6,064,077 bp
  • A to T, chromosome 19 at 16,533,764 bp
  • A to G, chromosome 19 at 25,430,341 bp
  • A to T, chromosome 19 at 38,702,017 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7037 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045137-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.