Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7037Btlr/Mmmh
Stock Number:
045137-MU
Citation ID:
RRID:MMRRC_045137-MU
Other Names:
R7037 (G1)
Major Collection:

Strain Information

Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Mc3r
Name: melanocortin 3 receptor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17201
HGNC: HGNC:6931
Homologene: 7412
Met
Name: met proto-oncogene, receptor tyrosine kinase
Synonyms: HGF receptor, c-Met, Par4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17295
HGNC: HGNC:7029
Homologene: 206
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Bicral
Name: BRD4 interacting chromatin remodeling complex associated protein like
Synonyms: BC032203, Gltscr1l
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210982
VEGA: 17
Homologene: 19366
Atp6v1h
Name: ATPase, H+ transporting, lysosomal V1 subunit H
Synonyms: 0710001F19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108664
Homologene: 7139
Eml4
Name: echinoderm microtubule associated protein like 4
Synonyms: 4930443C24Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78798
VEGA: 17
HGNC: HGNC:1316
Homologene: 56841
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 5,149,992 bp
  • C to A, chromosome 1 at 6,803,036 bp
  • T to C, chromosome 1 at 53,207,611 bp
  • G to A, chromosome 1 at 157,470,748 bp
  • T to C, chromosome 1 at 191,619,605 bp
  • A to C, chromosome 1 at 193,120,723 bp
  • A to T, chromosome 2 at 39,190,621 bp
  • C to T, chromosome 2 at 59,933,670 bp
  • T to A, chromosome 2 at 112,949,130 bp
  • G to T, chromosome 2 at 150,266,456 bp
  • A to G, chromosome 2 at 164,070,478 bp
  • CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT to CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT, chromosome 2 at 164,499,669 bp
  • A to G, chromosome 2 at 166,587,180 bp
  • T to C, chromosome 2 at 172,249,634 bp
  • T to C, chromosome 3 at 55,463,048 bp
  • G to A, chromosome 3 at 69,018,195 bp
  • T to A, chromosome 3 at 102,898,934 bp
  • A to T, chromosome 3 at 118,899,289 bp
  • A to G, chromosome 3 at 119,751,908 bp
  • T to C, chromosome 4 at 18,116,148 bp
  • T to A, chromosome 4 at 129,110,801 bp
  • T to C, chromosome 5 at 30,381,538 bp
  • A to T, chromosome 5 at 73,607,161 bp
  • A to G, chromosome 5 at 92,277,075 bp
  • A to G, chromosome 5 at 113,845,396 bp
  • G to A, chromosome 5 at 145,176,129 bp
  • A to T, chromosome 6 at 17,547,128 bp
  • T to C, chromosome 6 at 18,435,118 bp
  • A to G, chromosome 6 at 124,508,639 bp
  • G to T, chromosome 7 at 4,758,585 bp
  • A to G, chromosome 7 at 44,882,782 bp
  • A to G, chromosome 7 at 48,643,194 bp
  • T to C, chromosome 7 at 106,845,336 bp
  • A to T, chromosome 7 at 119,768,043 bp
  • T to A, chromosome 8 at 43,193,536 bp
  • A to G, chromosome 8 at 69,864,875 bp
  • T to A, chromosome 8 at 104,617,635 bp
  • A to T, chromosome 9 at 35,207,548 bp
  • T to A, chromosome 9 at 99,576,568 bp
  • T to C, chromosome 9 at 108,496,958 bp
  • G to T, chromosome 9 at 121,965,526 bp
  • T to A, chromosome 9 at 123,779,971 bp
  • T to A, chromosome 10 at 12,826,770 bp
  • C to T, chromosome 10 at 39,851,975 bp
  • T to A, chromosome 11 at 59,043,929 bp
  • T to C, chromosome 11 at 59,052,604 bp
  • A to G, chromosome 11 at 64,983,711 bp
  • A to T, chromosome 11 at 87,497,915 bp
  • A to G, chromosome 11 at 99,772,648 bp
  • C to A, chromosome 11 at 106,320,900 bp
  • T to A, chromosome 11 at 116,005,565 bp
  • T to A, chromosome 12 at 78,797,199 bp
  • A to T, chromosome 12 at 112,774,278 bp
  • A to G, chromosome 13 at 13,616,666 bp
  • C to T, chromosome 13 at 46,752,455 bp
  • C to T, chromosome 13 at 59,700,324 bp
  • A to G, chromosome 14 at 75,525,585 bp
  • G to A, chromosome 15 at 5,117,703 bp
  • A to G, chromosome 15 at 32,686,847 bp
  • A to G, chromosome 16 at 38,374,267 bp
  • G to A, chromosome 17 at 25,243,840 bp
  • T to A, chromosome 17 at 34,267,989 bp
  • T to C, chromosome 17 at 46,824,634 bp
  • T to A, chromosome 17 at 83,425,327 bp
  • G to T, chromosome 18 at 12,113,406 bp
  • T to G, chromosome 18 at 46,932,443 bp
  • A to G, chromosome 19 at 5,486,080 bp
  • A to T, chromosome 19 at 6,064,077 bp
  • A to T, chromosome 19 at 16,533,764 bp
  • A to G, chromosome 19 at 25,430,341 bp
  • A to T, chromosome 19 at 38,702,017 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7037 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045137-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.