Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7055Btlr/Mmmh
Stock Number:
045152-MU
Citation ID:
RRID:MMRRC_045152-MU
Other Names:
R7055 (G1)
Major Collection:

Strain Information

Casq2
Name: calsequestrin 2
Synonyms: cardiac calsequestrin, ESTM52, cCSQ, Csq2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12373
HGNC: HGNC:1513
Homologene: 20330
Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Myh9
Name: myosin, heavy polypeptide 9, non-muscle
Synonyms: D0Jmb2, E030044M24Rik, NMHC II-A, Myhn-1, Myhn1, myosin IIA, Fltn
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17886
HGNC: HGNC:7579
Homologene: 129835
Tnpo1
Name: transportin 1
Synonyms: D13Ertd688e, Kpnb2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238799
HGNC: HGNC:6401
Homologene: 5358
Eomes
Name: eomesodermin
Synonyms: Tbr2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13813
HGNC: HGNC:3372
Homologene: 3971
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Fzr1
Name: fizzy and cell division cycle 20 related 1
Synonyms: Fyr, Cdh1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 56371
Homologene: 9444
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 9,886,059 bp
  • A to T, chromosome 1 at 36,365,620 bp
  • A to G, chromosome 1 at 58,299,768 bp
  • A to G, chromosome 1 at 66,416,824 bp
  • T to C, chromosome 1 at 82,519,036 bp
  • A to T, chromosome 1 at 127,753,833 bp
  • A to G, chromosome 1 at 138,089,571 bp
  • T to A, chromosome 2 at 88,093,701 bp
  • C to T, chromosome 2 at 118,873,249 bp
  • A to G, chromosome 2 at 120,727,861 bp
  • TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT to TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT, chromosome 2 at 121,397,572 bp
  • A to G, chromosome 2 at 137,115,489 bp
  • T to A, chromosome 2 at 180,661,209 bp
  • G to A, chromosome 3 at 95,659,799 bp
  • A to G, chromosome 3 at 102,142,245 bp
  • T to C, chromosome 4 at 11,290,291 bp
  • A to G, chromosome 4 at 33,226,157 bp
  • G to A, chromosome 4 at 45,802,909 bp
  • A to T, chromosome 4 at 58,064,275 bp
  • A to T, chromosome 4 at 58,120,642 bp
  • A to T, chromosome 4 at 82,330,425 bp
  • A to T, chromosome 4 at 123,409,196 bp
  • A to G, chromosome 4 at 145,224,887 bp
  • TTCTCTCTCTCTCTC to TTCTCTCTCTCTCTCTC, chromosome 4 at 147,870,318 bp
  • G to T, chromosome 4 at 155,289,634 bp
  • A to G, chromosome 5 at 7,976,858 bp
  • T to C, chromosome 5 at 31,294,178 bp
  • C to A, chromosome 5 at 34,917,661 bp
  • T to C, chromosome 5 at 76,317,924 bp
  • T to C, chromosome 5 at 121,467,924 bp
  • A to C, chromosome 5 at 145,992,991 bp
  • T to C, chromosome 6 at 7,866,585 bp
  • C to A, chromosome 6 at 101,151,774 bp
  • T to A, chromosome 6 at 112,746,963 bp
  • A to G, chromosome 6 at 145,621,209 bp
  • A to G, chromosome 7 at 28,404,033 bp
  • C to T, chromosome 7 at 32,210,482 bp
  • T to C, chromosome 7 at 126,445,313 bp
  • T to C, chromosome 7 at 127,487,784 bp
  • A to C, chromosome 8 at 85,548,674 bp
  • A to G, chromosome 9 at 22,013,161 bp
  • T to A, chromosome 9 at 59,313,193 bp
  • A to G, chromosome 9 at 98,410,233 bp
  • A to T, chromosome 9 at 118,480,499 bp
  • C to T, chromosome 10 at 12,747,921 bp
  • G to C, chromosome 10 at 75,743,283 bp
  • C to T, chromosome 10 at 79,067,847 bp
  • T to C, chromosome 10 at 81,370,223 bp
  • T to A, chromosome 10 at 82,059,998 bp
  • T to C, chromosome 10 at 87,226,221 bp
  • T to C, chromosome 11 at 53,688,102 bp
  • T to A, chromosome 11 at 59,177,030 bp
  • T to C, chromosome 11 at 88,999,924 bp
  • T to A, chromosome 11 at 93,955,590 bp
  • A to G, chromosome 11 at 106,777,214 bp
  • A to G, chromosome 11 at 115,285,403 bp
  • A to G, chromosome 12 at 52,024,253 bp
  • A to T, chromosome 12 at 54,784,079 bp
  • T to C, chromosome 12 at 81,724,208 bp
  • A to T, chromosome 12 at 91,586,749 bp
  • T to A, chromosome 12 at 112,735,715 bp
  • T to A, chromosome 13 at 25,004,954 bp
  • G to T, chromosome 13 at 98,855,479 bp
  • T to A, chromosome 14 at 62,900,299 bp
  • A to T, chromosome 14 at 118,594,785 bp
  • A to G, chromosome 15 at 75,678,674 bp
  • C to T, chromosome 15 at 77,775,198 bp
  • T to A, chromosome 15 at 101,461,125 bp
  • A to G, chromosome 16 at 13,626,134 bp
  • T to A, chromosome 16 at 17,317,015 bp
  • T to C, chromosome 16 at 62,928,102 bp
  • G to A, chromosome 16 at 89,403,703 bp
  • A to C, chromosome 17 at 12,704,323 bp
  • T to C, chromosome 17 at 22,559,051 bp
  • A to T, chromosome 17 at 23,953,302 bp
  • A to G, chromosome 18 at 37,490,811 bp
  • T to C, chromosome 19 at 32,664,427 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7055 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045152-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.