Strain Name:
C57BL/6J-MtgxR7055Btlr/Mmmh
Stock Number:
045152-MU
Citation ID:
RRID:MMRRC_045152-MU
Other Names:
R7055 (G1)
Major Collection:

Strain Information

Casq2
Name: calsequestrin 2
Synonyms: cardiac calsequestrin, ESTM52, Csq2, cCSQ
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12373
HGNC: HGNC:1513
Homologene: 20330
Utrn
Name: utrophin
Synonyms: G-utrophin, DRP, Dmdl
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Myh9
Name: myosin, heavy polypeptide 9, non-muscle
Synonyms: D0Jmb2, Myhn1, NMHC II-A, Fltn, Myhn-1, myosin IIA, E030044M24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17886
HGNC: HGNC:7579
Homologene: 129835
Tnpo1
Name: transportin 1
Synonyms: Kpnb2, D13Ertd688e
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238799
HGNC: HGNC:6401
Homologene: 5358
Eomes
Name: eomesodermin
Synonyms: Tbr2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13813
HGNC: HGNC:3372
Homologene: 3971
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Aclp7, Acf7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Fzr1
Name: fizzy and cell division cycle 20 related 1
Synonyms: Fyr, Cdh1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 56371
Homologene: 9444
Nfib
Name: nuclear factor I/B
Synonyms: E030026I10Rik, 6720429L07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18028
HGNC: HGNC:7785
Homologene: 4087
Gtf2a1
Name: general transcription factor II A, 1
Synonyms: TfIIAa/b, Tfiia1, 19kDa, 6330549H03Rik, 37kDa
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 83602
HGNC: HGNC:4646
Homologene: 56331
Dido1
Name: death inducer-obliterator 1
Synonyms: C130092D22Rik, D130048F08Rik, dido, Datf1, DIO-1, 6720461J16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 23856
HGNC: HGNC:2680
Homologene: 34139
Cabin1
Name: calcineurin binding protein 1
Synonyms: Cain, Ppp3in, A330070M20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 104248
VEGA: 10
Homologene: 49307
Snx6
Name: sorting nexin 6
Synonyms: 2010006G21Rik, 2810425K19Rik, 2610032J07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72183
VEGA: 12
Homologene: 12304
Pi4ka
Name: phosphatidylinositol 4-kinase alpha
Synonyms: Pik4ca
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224020
HGNC: HGNC:8983
Homologene: 11171
Samd4b
Name: sterile alpha motif domain containing 4B
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233033
Homologene: 35268
Mcl1
Name: myeloid cell leukemia sequence 1
Synonyms: Mcl-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17210
HGNC: HGNC:6943
Homologene: 7413
Abcc4
Name: ATP-binding cassette, sub-family C member 4
Synonyms: MOAT-B, D630049P08Rik, MRP4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239273
VEGA: 14
HGNC: HGNC:55
Homologene: 74563
Parn
Name: poly(A)-specific ribonuclease (deadenylation nuclease)
Synonyms: 1200003I18Rik, DAN
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74108
VEGA: 16
HGNC: HGNC:8609
Homologene: 31098
Dnaja2
Name: DnaJ heat shock protein family (Hsp40) member A2
Synonyms: mDj3, DNJ3, PRO3015, 1500017M13Rik, 2010206B19Rik, HIRIP4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56445
Homologene: 21193
Rad50
Name: RAD50 double strand break repair protein
Synonyms: Rad50l, Mrell
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19360
HGNC: HGNC:9816
Homologene: 38092
Ptprc
Name: protein tyrosine phosphatase receptor type C
Synonyms: T200, Lyt-4, Ly-5, B220, CD45
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19264
HGNC: HGNC:9666
Homologene: 2126
Kansl3
Name: KAT8 regulatory NSL complex subunit 3
Synonyms: 4632411B12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226976
Homologene: 9949
Sgk3
Name: serum/glucocorticoid regulated kinase 3
Synonyms: cytokine-independent survival kinase, Cisk, 2510015P22Rik, A330005P07Rik, fy
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 170755
Homologene: 56582
Cdan1
Name: codanin 1
Synonyms: CDA1, 1500015A01Rik, CDA-I, codanin-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68968
HGNC: HGNC:1713
Homologene: 16324
Igf2r
Name: insulin-like growth factor 2 receptor
Synonyms: IGF-II/CI-MPR, CI-MPR, mannose-6-phosphate receptor, cation independent, M6P/IGF2R, Mpr300, CD222
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16004
HGNC: HGNC:5467
Homologene: 676
Map2
Name: microtubule-associated protein 2
Synonyms: G1-397-34, Mtap2, repro4, MAP-2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17756
HGNC: HGNC:6839
Homologene: 1779
Trim25
Name: tripartite motif-containing 25
Synonyms: estrogen-responsive finger protein, Zfp147
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217069
Homologene: 48325
Pros1
Name: protein S (alpha)
Synonyms: protein S
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19128
HGNC: HGNC:9456
Homologene: 264
2610008E11Rik
Name: RIKEN cDNA 2610008E11 gene
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 72128
Homologene: 86705
Cep170b
Name: centrosomal protein 170B
Synonyms: AW555464
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217882
VEGA: 12
Homologene: 46165
Dpy19l4
Name: dpy-19 like 4
Synonyms: Narg3, LOC381510
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381510
Homologene: 18773
Pcdhb18
Name: protocadherin beta 18
Synonyms: PcdhbR, Pcdhb9
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93889
Homologene: 137649
Col4a4
Name: collagen, type IV, alpha 4
Synonyms: [a]4(IV), E130010M05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12829
HGNC: HGNC:2206
Homologene: 20071
Jag1
Name: jagged 1
Synonyms: Gsfabe2, Headturner, ABE2, Ozz, Serrate-1, Htu
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16449
HGNC: HGNC:6188
Homologene: 180
Svep1
Name: sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Synonyms: 1110021D17Rik, Polydom, D430029O09Rik, 4833413O10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 64817
Homologene: 23386
Srgap3
Name: SLIT-ROBO Rho GTPase activating protein 3
Synonyms: D130026O08Rik, Arhgap14
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 259302
Homologene: 56686
Tmem116
Name: transmembrane protein 116
Synonyms: 4930406A18Rik, 4930513P12Rik, C030022K24Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77462
Homologene: 12676
Tnfrsf1b
Name: tumor necrosis factor receptor superfamily, member 1b
Synonyms: CD120b, TNF-R75, TNF-R-II, TNFR80, TNFBR, TNFRII, p75 TNFR, TNF-R2, Tnfr2, TNF-alphaR2, p75, TNFalpha-R2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21938
Homologene: 829
Aox2
Name: aldehyde oxidase 2
Synonyms: Aox3l1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213043
Homologene: 84622
Vmn2r111
Name: vomeronasal 2, receptor 111
Synonyms: EG210876
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210876
Homologene: 86604
Krt81
Name: keratin 81
Synonyms: Krt2-19
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 64818
VEGA: 15
HGNC: HGNC:6458
Homologene: 55645
C1galt1
Name: core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1
Synonyms: core 1 beta3-Gal-T, 2210410E06Rik, T-synthase
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 94192
Homologene: 10599
Tuba3b
Name: tubulin, alpha 3B
Synonyms: Tuba7, M[a]7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22147
Homologene: 128229
Gjc2
Name: gap junction protein, gamma 2
Synonyms: Cx47, B230382L12Rik, Gja12, connexin 47
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 118454
Homologene: 10715
Papss2
Name: 3'-phosphoadenosine 5'-phosphosulfate synthase 2
Synonyms: Sk2, Atpsk2, 1810018P12Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 23972
VEGA: 19
HGNC: HGNC:8604
Homologene: 55840
Fbrs
Name: fibrosin
Synonyms: Fbs1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14123
Homologene: 79554
Polg2
Name: polymerase (DNA directed), gamma 2, accessory subunit
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 50776
HGNC: HGNC:9180
Homologene: 5221
Pdzrn3
Name: PDZ domain containing RING finger 3
Synonyms: LNX3, Semcap3, semaphorin cytoplasmic domain-associated protein 3A, 1110020C07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 55983
Homologene: 10328
Krtap21-1
Name: keratin associated protein 21-1
Synonyms: Krtap16-7, 1110017B05Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 170656
VEGA: 16
Srsf12
Name: serine and arginine-rich splicing factor 12
Synonyms: Sfrs13b, Srrp
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 272009
Mrs2
Name: MRS2 magnesium transporter
Synonyms: Mrs2l, LOC380836
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 380836
Homologene: 31983
Or5d37
Name: olfactory receptor family 5 subfamily D member 37
Synonyms: Olfr1164, MOR174-11, GA_x6K02T2Q125-49585842-49584862
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258634
Homologene: 74077
1700113H08Rik
Name: RIKEN cDNA 1700113H08 gene
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 76640
Homologene: 45695
Pdcl2
Name: phosducin-like 2
Synonyms: Mgcphlp, 1700010B22Rik, 1700016K07Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 79455
Homologene: 74832
Prkcsh
Name: protein kinase C substrate 80K-H
Synonyms: hepatocystin, 80K-H
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19089
VEGA: 9
HGNC: HGNC:9411
Homologene: 2056
Steap4
Name: STEAP family member 4
Synonyms: Tiarp, Tnfaip9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 117167
Homologene: 36422
Cyp3a25
Name: cytochrome P450, family 3, subfamily a, polypeptide 25
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56388
Homologene: 135775
Prkcz
Name: protein kinase C, zeta
Synonyms: zetaPKC, aPKCzeta, Pkcz
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18762
HGNC: HGNC:9412
Homologene: 55681
Wdfy2
Name: WD repeat and FYVE domain containing 2
Synonyms: B130024L21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268752
VEGA: 14
Homologene: 14188
Map3k9
Name: mitogen-activated protein kinase kinase kinase 9
Synonyms: Mlk1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 338372
VEGA: 12
HGNC: HGNC:6861
Homologene: 76377
Acmsd
Name: amino carboxymuconate semialdehyde decarboxylase
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 266645
Homologene: 44520
Msantd1
Name: Myb/SANT-like DNA-binding domain containing 1
Synonyms: LOC231132, A930005I04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 403174
Homologene: 45807
Fads6
Name: fatty acid desaturase domain family, member 6
Synonyms: BC050213, OTTMUSG00000021749
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 328035
Homologene: 18646
Aldh1b1
Name: aldehyde dehydrogenase 1 family, member B1
Synonyms: 2700007F14Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72535
HGNC: HGNC:407
Homologene: 115470
Zfp873
Name: zinc finger protein 873
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 408062
Homologene: 134319
Rabep2
Name: rabaptin, RAB GTPase binding effector protein 2
Synonyms: 2610011A08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70314
Homologene: 23489
Gpr33
Name: G protein-coupled receptor 33
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14762
HGNC: HGNC:4489
Homologene: 7345
Adpgk
Name: ADP-dependent glucokinase
Synonyms: 2610017G09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72141
VEGA: 9
Homologene: 41739
Top1mt
Name: DNA topoisomerase 1, mitochondrial
Synonyms: 2900052H09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72960
Homologene: 43082
Nme2
Name: NME/NM23 nucleoside diphosphate kinase 2
Synonyms: non-metastatic cells 2, protein (NM23B) expressed in, nm23-M2, NM23-H2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18103
Homologene: 133879
Ivd
Name: isovaleryl coenzyme A dehydrogenase
Synonyms: 1300016K07Rik, 6720455E18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56357
HGNC: HGNC:6186
Homologene: 1676
Sbpl
Name: spermine binding protein-like
Synonyms: 2310068J22Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 638345
VEGA: 17
Homologene: 117464
Catsper2
Name: cation channel, sperm associated 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 212670
Homologene: 77423
Fndc4
Name: fibronectin type III domain containing 4
Synonyms: 6330410H20Rik, 2810430J06Rik, FRCP1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 64339
Homologene: 49716
Nmnat3
Name: nicotinamide nucleotide adenylyltransferase 3
Synonyms: PNAT3, 4933408N02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74080
Homologene: 39772
Fv1
Name: Friend virus susceptibility 1
Synonyms: Rv1, Fv-1, Rv-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14349
Scgb2b11
Name: secretoglobin, family 2B, member 11
Synonyms: Abpbg11, Gm4687
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043842
Homologene: 83171
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 9,886,059 bp
  • A to T, chromosome 1 at 36,365,620 bp
  • A to G, chromosome 1 at 58,299,768 bp
  • A to G, chromosome 1 at 66,416,824 bp
  • T to C, chromosome 1 at 82,519,036 bp
  • A to T, chromosome 1 at 127,753,833 bp
  • A to G, chromosome 1 at 138,089,571 bp
  • T to A, chromosome 2 at 88,093,701 bp
  • C to T, chromosome 2 at 118,873,249 bp
  • A to G, chromosome 2 at 120,727,861 bp
  • TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT to TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT, chromosome 2 at 121,397,572 bp
  • A to G, chromosome 2 at 137,115,489 bp
  • T to A, chromosome 2 at 180,661,209 bp
  • G to A, chromosome 3 at 95,659,799 bp
  • A to G, chromosome 3 at 102,142,245 bp
  • T to C, chromosome 4 at 11,290,291 bp
  • A to G, chromosome 4 at 33,226,157 bp
  • G to A, chromosome 4 at 45,802,909 bp
  • A to T, chromosome 4 at 58,064,275 bp
  • A to T, chromosome 4 at 58,120,642 bp
  • A to T, chromosome 4 at 82,330,425 bp
  • A to T, chromosome 4 at 123,409,196 bp
  • A to G, chromosome 4 at 145,224,887 bp
  • TTCTCTCTCTCTCTC to TTCTCTCTCTCTCTCTC, chromosome 4 at 147,870,318 bp
  • G to T, chromosome 4 at 155,289,634 bp
  • A to G, chromosome 5 at 7,976,858 bp
  • T to C, chromosome 5 at 31,294,178 bp
  • C to A, chromosome 5 at 34,917,661 bp
  • T to C, chromosome 5 at 76,317,924 bp
  • T to C, chromosome 5 at 121,467,924 bp
  • A to C, chromosome 5 at 145,992,991 bp
  • T to C, chromosome 6 at 7,866,585 bp
  • C to A, chromosome 6 at 101,151,774 bp
  • T to A, chromosome 6 at 112,746,963 bp
  • A to G, chromosome 6 at 145,621,209 bp
  • A to G, chromosome 7 at 28,404,033 bp
  • C to T, chromosome 7 at 32,210,482 bp
  • T to C, chromosome 7 at 126,445,313 bp
  • T to C, chromosome 7 at 127,487,784 bp
  • A to C, chromosome 8 at 85,548,674 bp
  • A to G, chromosome 9 at 22,013,161 bp
  • T to A, chromosome 9 at 59,313,193 bp
  • A to G, chromosome 9 at 98,410,233 bp
  • A to T, chromosome 9 at 118,480,499 bp
  • C to T, chromosome 10 at 12,747,921 bp
  • G to C, chromosome 10 at 75,743,283 bp
  • C to T, chromosome 10 at 79,067,847 bp
  • T to C, chromosome 10 at 81,370,223 bp
  • T to A, chromosome 10 at 82,059,998 bp
  • T to C, chromosome 10 at 87,226,221 bp
  • T to C, chromosome 11 at 53,688,102 bp
  • T to A, chromosome 11 at 59,177,030 bp
  • T to C, chromosome 11 at 88,999,924 bp
  • T to A, chromosome 11 at 93,955,590 bp
  • A to G, chromosome 11 at 106,777,214 bp
  • A to G, chromosome 11 at 115,285,403 bp
  • A to G, chromosome 12 at 52,024,253 bp
  • A to T, chromosome 12 at 54,784,079 bp
  • T to C, chromosome 12 at 81,724,208 bp
  • A to T, chromosome 12 at 91,586,749 bp
  • T to A, chromosome 12 at 112,735,715 bp
  • T to A, chromosome 13 at 25,004,954 bp
  • G to T, chromosome 13 at 98,855,479 bp
  • T to A, chromosome 14 at 62,900,299 bp
  • A to T, chromosome 14 at 118,594,785 bp
  • A to G, chromosome 15 at 75,678,674 bp
  • C to T, chromosome 15 at 77,775,198 bp
  • T to A, chromosome 15 at 101,461,125 bp
  • A to G, chromosome 16 at 13,626,134 bp
  • T to A, chromosome 16 at 17,317,015 bp
  • T to C, chromosome 16 at 62,928,102 bp
  • G to A, chromosome 16 at 89,403,703 bp
  • A to C, chromosome 17 at 12,704,323 bp
  • T to C, chromosome 17 at 22,559,051 bp
  • A to T, chromosome 17 at 23,953,302 bp
  • A to G, chromosome 18 at 37,490,811 bp
  • T to C, chromosome 19 at 32,664,427 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7055 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045152-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.