Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7075Btlr/Mmmh
Stock Number:
045170-MU
Citation ID:
RRID:MMRRC_045170-MU
Other Names:
R7075 (G1)
Major Collection:

Strain Information

Rnf220
Name: ring finger protein 220
Synonyms: 5730503K05Rik, 4931406I20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66743
Homologene: 10036
Phf21a
Name: PHD finger protein 21A
Synonyms: 80kDa, Braf35/HDAC complex (Bhc), PFTF1, Bhc80, D030065N23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 192285
Homologene: 9597
Recql4
Name: RecQ protein-like 4
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 79456
VEGA: 15
HGNC: HGNC:9949
Homologene: 3144
Hars1
Name: histidyl-tRNA synthetase 1
Synonyms: MMHRS, Hars
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 15115
VEGA: 18
HGNC: HGNC:4816
Homologene: 1592
Cct2
Name: chaperonin containing TCP1 subunit 2
Synonyms: Cctb
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12461
VEGA: 10
HGNC: HGNC:1615
Homologene: 4696
Tubgcp5
Name: tubulin, gamma complex component 5
Synonyms: GCP5, B130010C12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233276
Homologene: 14172
Atf7ip
Name: activating transcription factor 7 interacting protein
Synonyms: ATFa-associated Modulator, AM, 2610204M12Rik, Mcaf1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54343
Homologene: 10051
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 175,607,855 bp
  • T to A, chromosome 1 at 180,961,149 bp
  • A to T, chromosome 1 at 182,158,032 bp
  • T to C, chromosome 2 at 25,795,280 bp
  • T to C, chromosome 2 at 31,058,914 bp
  • T to C, chromosome 2 at 36,569,180 bp
  • T to C, chromosome 2 at 76,716,829 bp
  • T to A, chromosome 2 at 79,635,660 bp
  • T to C, chromosome 2 at 85,400,200 bp
  • T to A, chromosome 2 at 85,674,824 bp
  • T to G, chromosome 2 at 86,922,646 bp
  • C to T, chromosome 2 at 92,360,379 bp
  • C to T, chromosome 2 at 118,420,810 bp
  • T to C, chromosome 2 at 121,321,750 bp
  • T to A, chromosome 2 at 143,848,965 bp
  • A to T, chromosome 3 at 30,896,777 bp
  • C to T, chromosome 3 at 109,525,924 bp
  • A to T, chromosome 4 at 117,285,882 bp
  • T to C, chromosome 4 at 118,622,102 bp
  • T to C, chromosome 4 at 140,933,217 bp
  • A to C, chromosome 5 at 124,320,859 bp
  • G to A, chromosome 5 at 124,571,251 bp
  • T to C, chromosome 6 at 136,596,515 bp
  • T to C, chromosome 7 at 18,654,861 bp
  • G to T, chromosome 7 at 55,829,407 bp
  • A to T, chromosome 7 at 57,323,696 bp
  • A to T, chromosome 7 at 111,556,388 bp
  • A to T, chromosome 7 at 127,203,238 bp
  • G to T, chromosome 7 at 132,759,623 bp
  • A to G, chromosome 8 at 70,677,785 bp
  • T to A, chromosome 9 at 19,884,063 bp
  • C to T, chromosome 9 at 21,231,256 bp
  • T to C, chromosome 9 at 37,919,074 bp
  • T to C, chromosome 9 at 76,056,552 bp
  • G to T, chromosome 10 at 7,152,931 bp
  • T to C, chromosome 10 at 105,829,924 bp
  • G to T, chromosome 10 at 107,778,929 bp
  • A to T, chromosome 10 at 117,061,465 bp
  • T to A, chromosome 10 at 130,391,072 bp
  • T to A, chromosome 10 at 130,422,688 bp
  • T to C, chromosome 11 at 100,879,693 bp
  • T to A, chromosome 11 at 101,893,743 bp
  • T to A, chromosome 11 at 117,835,705 bp
  • A to G, chromosome 12 at 30,940,166 bp
  • C to A, chromosome 12 at 55,820,723 bp
  • A to T, chromosome 12 at 85,279,008 bp
  • G to T, chromosome 14 at 24,177,797 bp
  • T to C, chromosome 14 at 29,970,067 bp
  • T to G, chromosome 14 at 30,892,603 bp
  • C to G, chromosome 14 at 31,552,909 bp
  • A to T, chromosome 14 at 105,160,607 bp
  • A to T, chromosome 15 at 27,898,000 bp
  • C to T, chromosome 15 at 76,124,399 bp
  • A to G, chromosome 15 at 76,706,424 bp
  • A to G, chromosome 15 at 98,058,326 bp
  • T to C, chromosome 17 at 8,566,803 bp
  • A to G, chromosome 17 at 26,925,898 bp
  • A to G, chromosome 17 at 43,625,174 bp
  • T to C, chromosome 18 at 36,559,989 bp
  • T to C, chromosome 18 at 36,772,355 bp
  • A to G, chromosome 19 at 5,496,990 bp
  • T to C, chromosome 19 at 38,124,061 bp
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7075 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045170-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.