Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7083Btlr/Mmmh
Stock Number:
045177-MU
Citation ID:
RRID:MMRRC_045177-MU
Other Names:
R7083 (G1)
Major Collection:

Strain Information

Cd4
Name: CD4 antigen
Synonyms: L3T4, Ly-4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12504
HGNC: HGNC:1678
Homologene: 513
Ntrk3
Name: neurotrophic tyrosine kinase, receptor, type 3
Synonyms: TrkC
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18213
HGNC: HGNC:8033
Homologene: 49183
Frem2
Name: Fras1 related extracellular matrix protein 2
Synonyms: 8430406N05Rik, 6030440P17Rik, my, ne, b2b1562Clo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242022
Homologene: 18454
Arpp21
Name: cyclic AMP-regulated phosphoprotein, 21
Synonyms: ARPP-21, Tarpp, D9Bwg1012e, 0710001E13Rik, R3hdm3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74100
Homologene: 32306
Itch
Name: itchy, E3 ubiquitin protein ligase
Synonyms: 6720481N21Rik, C230047C07Rik, 8030492O04Rik, AIP4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16396
Homologene: 88442
Shroom3
Name: shroom family member 3
Synonyms: D5Ertd287e, Shrm, Shrm3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27428
Homologene: 9263
Mast4
Name: microtubule associated serine/threonine kinase family member 4
Synonyms: 4930420O11Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 328329
Homologene: 42094
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 125,677,418 bp
  • A to G, chromosome 2 at 62,234,495 bp
  • A to G, chromosome 2 at 89,993,857 bp
  • A to C, chromosome 2 at 119,752,074 bp
  • A to T, chromosome 2 at 155,210,444 bp
  • T to C, chromosome 2 at 181,670,372 bp
  • T to A, chromosome 3 at 53,537,493 bp
  • T to A, chromosome 3 at 133,132,436 bp
  • T to C, chromosome 4 at 73,790,984 bp
  • T to C, chromosome 5 at 45,523,536 bp
  • G to A, chromosome 5 at 74,628,185 bp
  • T to C, chromosome 5 at 92,964,525 bp
  • C to T, chromosome 6 at 5,969,429 bp
  • A to G, chromosome 6 at 22,123,580 bp
  • T to G, chromosome 6 at 124,870,572 bp
  • A to T, chromosome 6 at 145,169,783 bp
  • T to A, chromosome 7 at 8,378,370 bp
  • G to A, chromosome 7 at 18,480,009 bp
  • T to A, chromosome 7 at 30,868,048 bp
  • G to A, chromosome 7 at 44,191,801 bp
  • A to G, chromosome 7 at 44,710,333 bp
  • C to T, chromosome 7 at 55,800,695 bp
  • T to A, chromosome 7 at 78,250,839 bp
  • T to C, chromosome 7 at 81,973,310 bp
  • T to A, chromosome 7 at 90,176,768 bp
  • T to A, chromosome 7 at 96,895,349 bp
  • ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,713 bp
  • A to G, chromosome 8 at 31,091,719 bp
  • GCCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA to GCCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA, chromosome 8 at 66,860,486 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • T to C, chromosome 8 at 110,089,136 bp
  • T to C, chromosome 8 at 119,600,668 bp
  • C to A, chromosome 8 at 120,085,427 bp
  • T to C, chromosome 9 at 39,597,647 bp
  • A to G, chromosome 9 at 112,183,544 bp
  • A to G, chromosome 10 at 58,479,230 bp
  • G to T, chromosome 10 at 78,587,069 bp
  • A to G, chromosome 10 at 127,177,168 bp
  • G to T, chromosome 11 at 58,919,137 bp
  • T to G, chromosome 11 at 103,117,166 bp
  • T to C, chromosome 11 at 103,503,340 bp
  • A to G, chromosome 12 at 16,723,314 bp
  • A to T, chromosome 12 at 57,239,248 bp
  • A to G, chromosome 12 at 75,943,888 bp
  • A to T, chromosome 12 at 81,560,241 bp
  • A to G, chromosome 12 at 102,788,335 bp
  • A to C, chromosome 13 at 102,737,715 bp
  • T to G, chromosome 14 at 25,651,948 bp
  • G to A, chromosome 14 at 50,299,279 bp
  • C to A, chromosome 15 at 103,482,124 bp
  • T to C, chromosome 16 at 55,818,300 bp
  • T to C, chromosome 16 at 59,110,037 bp
  • T to A, chromosome 17 at 21,560,130 bp
  • G to T, chromosome 17 at 27,560,971 bp
  • T to C, chromosome 17 at 37,406,172 bp
  • T to A, chromosome 17 at 38,130,710 bp
  • T to C, chromosome 18 at 35,734,650 bp
  • T to C, chromosome 18 at 89,090,598 bp
  • A to G, chromosome 19 at 5,463,631 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7083 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045177-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.