Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7083Btlr/Mmmh
Stock Number:
045177-MU
Citation ID:
RRID:MMRRC_045177-MU
Other Names:
R7083 (G1)
Major Collection:

Strain Information

Cd4
Name: CD4 antigen
Synonyms: L3T4, Ly-4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12504
HGNC: HGNC:1678
Homologene: 513
Ntrk3
Name: neurotrophic tyrosine kinase, receptor, type 3
Synonyms: TrkC
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18213
HGNC: HGNC:8033
Homologene: 49183
Frem2
Name: Fras1 related extracellular matrix protein 2
Synonyms: 8430406N05Rik, 6030440P17Rik, my, ne, b2b1562Clo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242022
Homologene: 18454
Arpp21
Name: cyclic AMP-regulated phosphoprotein, 21
Synonyms: ARPP-21, Tarpp, D9Bwg1012e, 0710001E13Rik, R3hdm3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74100
Homologene: 32306
Itch
Name: itchy, E3 ubiquitin protein ligase
Synonyms: 6720481N21Rik, C230047C07Rik, 8030492O04Rik, AIP4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16396
Homologene: 88442
Shroom3
Name: shroom family member 3
Synonyms: D5Ertd287e, Shrm, Shrm3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27428
Homologene: 9263
Mast4
Name: microtubule associated serine/threonine kinase family member 4
Synonyms: 4930420O11Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 328329
Homologene: 42094
Tubgcp5
Name: tubulin, gamma complex component 5
Synonyms: GCP5, B130010C12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233276
Homologene: 14172
Ranbp2
Name: RAN binding protein 2
Synonyms: A430087B05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19386
VEGA: 10
HGNC: HGNC:9848
Homologene: 87808
Picalm
Name: phosphatidylinositol binding clathrin assembly protein
Synonyms: fit-1, fit1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233489
Homologene: 111783
Rttn
Name: rotatin
Synonyms: 4921538A15Rik, C530033I08Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 246102
VEGA: 18
Homologene: 65275
Naf1
Name: nuclear assembly factor 1 ribonucleoprotein
Synonyms: LOC234344
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234344
Homologene: 128518
Tenm4
Name: teneurin transmembrane protein 4
Synonyms: l(7)-3Rn, Ten-m4, Doc4, l7Rn3, ELM2, Odz4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23966
Homologene: 8034
Hmga1
Name: high mobility group AT-hook 1
Synonyms: HMGY, HMG-I(Y), Hmgi, Hmgiy, HMGI(Y), Hmga1b, Hmga1a
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15361
HGNC: HGNC:5010
Homologene: 128226
Taf1c
Name: TATA-box binding protein associated factor, RNA polymerase I, C
Synonyms: mTAFI95
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 21341
Homologene: 21163
Hexim1
Name: hexamethylene bis-acetamide inducible 1
Synonyms: HIS1, CLP-1, 7330426E13Rik, Clp1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192231
Homologene: 31382
Zmiz1
Name: zinc finger, MIZ-type containing 1
Synonyms: Rai17, Zimp10
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 328365
Homologene: 10667
Cd22
Name: CD22 antigen
Synonyms: Lyb-8, Lyb8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12483
HGNC: HGNC:1643
Homologene: 31052
Med28
Name: mediator complex subunit 28
Synonyms: Eg1, 1500003D12Rik, magicin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66999
Homologene: 11873
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, Cpfl8, diminished cone electroretinogram, dice
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319565
Homologene: 56700
Rasef
Name: RAS and EF hand domain containing
Synonyms: RAB45
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242505
Homologene: 28424
Lrrc37a
Name: leucine rich repeat containing 37A
Synonyms: LOC237954
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237954
Homologene: 138824
Izumo2
Name: IZUMO family member 2
Synonyms: 1700023D19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75510
Syde1
Name: synapse defective 1, Rho GTPase, homolog 1 (C. elegans)
Synonyms: 1200008N06Rik, mSYD1A
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71709
VEGA: 10
Homologene: 13195
Nckap1l
Name: NCK associated protein 1 like
Synonyms: 4930568P13Rik, Hem1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105855
VEGA: 15
HGNC: HGNC:4862
Homologene: 3901
Dusp26
Name: dual specificity phosphatase 26
Synonyms: 2310043K02Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66959
Homologene: 11421
Cped1
Name: cadherin-like and PC-esterase domain containing 1
Synonyms: A430107O13Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 214642
Homologene: 57014
Arhgef38
Name: Rho guanine nucleotide exchange factor 38
Synonyms: 9130221D24Rik, D630013G24Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77669
Homologene: 137396
Or2h15
Name: olfactory receptor family 2 subfamily H member 15
Synonyms: MOR256-49, GA_x6K02T2PSCP-2579687-2578746, Olfr132
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 257889
Homologene: 46430
Greb1
Name: gene regulated by estrogen in breast cancer protein
Synonyms: 5730583K22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 268527
Homologene: 8780
Slc4a10
Name: solute carrier family 4, sodium bicarbonate cotransporter-like, member 10
Synonyms: NCBE
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94229
Homologene: 23340
Bnc1
Name: basonuclin zinc finger protein 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12173
HGNC: HGNC:1081
Homologene: 31048
Gpr39
Name: G protein-coupled receptor 39
Synonyms: 4933415E13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71111
HGNC: HGNC:4496
Homologene: 20380
Or4c126
Name: olfactory receptor family 4 subfamily C member 126
Synonyms: GA_x6K02T2Q125-51425355-51426275, MOR234-3, Olfr1261
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258466
Homologene: 138310
Psg26
Name: pregnancy-specific beta-1-glycoprotein 26
Synonyms: cea14, EG574429
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 574429
Homologene: 110989
Sting1
Name: stimulator of interferon response cGAMP interactor 1
Synonyms: 2610307O08Rik, MPYS, ERIS, Sting, Tmem173
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 72512
VEGA: 18
Homologene: 18868
Irag2
Name: inositol 1,4,5-triphosphate receptor associated 2
Synonyms: Jaw1, D6Int7, D6Int8, D6Int5, D6Int4, D6Int3, Lrmp
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16970
HGNC: HGNC:6690
Homologene: 4483
Zfp52
Name: zinc finger protein 52
Synonyms: zfec29, Zfp-52, KRAB11, Zfp76
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22710
VEGA: 17
Homologene: 77326
Adam21
Name: a disintegrin and metallopeptidase domain 21
Synonyms: ADAM31
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56622
HGNC: HGNC:200
Homologene: 68365
Nfkbiz
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, zeta
Synonyms: Mail
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 80859
Homologene: 12734
Zdhhc7
Name: zinc finger, DHHC domain containing 7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102193
Homologene: 41193
Btnl10
Name: butyrophilin-like 10
Synonyms: BUTR-1, Butr1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192194
Homologene: 138184
Dync1i1
Name: dynein cytoplasmic 1 intermediate chain 1
Synonyms: IC74, DIC, Dncic1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13426
HGNC: HGNC:2963
Homologene: 68398
Fibp
Name: fibroblast growth factor (acidic) intracellular binding protein
Synonyms: 2010004G08Rik, 3010027N18Rik, 2010005N21Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 58249
VEGA: 19
HGNC: HGNC:3705
Homologene: 3106
Or4n4b
Name: olfactory receptor family 4 subfamily N member 4B
Synonyms: GA_x6K02T2PMLR-5992342-5991416, MOR241-2, Olfr733
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258657
Homologene: 128266
Or5h25
Name: olfactory receptor family 5 subfamily H member 25
Synonyms: GA_x54KRFPKG5P-55338697-55337768, MOR113-7P, MOR183-7P, MOR113-7P, Olfr1540-ps1, Olfr193
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 257972
Homologene: 128162
Or1o1
Name: olfactory receptor family 1 subfamily O member 1
Synonyms: MOR156-3, GA_x6K02T2PSCP-1867165-1868094, Olfr107
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258504
Homologene: 115498
Slc26a10
Name: solute carrier family 26, member 10
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216441
VEGA: 10
Homologene: 66953
Btbd7
Name: BTB domain containing 7
Synonyms: FUP1, 5730507E09Rik, E130118E17Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238386
VEGA: 12
Homologene: 34300
Klk1b24
Name: kallikrein 1-related peptidase b24
Synonyms: mGk-24, Klk24
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16617
HGNC: HGNC:6357
Homologene: 68141
Vmn2r44
Name: vomeronasal 2, receptor 44
Synonyms: EG434113
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434113
Homologene: 113703
Prps1l3
Name: phosphoribosyl pyrophosphate synthetase 1-like 3
Synonyms: Gm5081
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 328099
HGNC: HGNC:9462
Homologene: 68565
Zfp612
Name: zinc finger protein 612
Synonyms: B230354B21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234725
Homologene: 27083
Sox18
Name: SRY (sex determining region Y)-box 18
Synonyms: Sry-related HMG-box gene 18, Ragl
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20672
Homologene: 7546
Krtap5-24
Name: keratin associated protein 5-24
Synonyms: Gm40460
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 105244938
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 125,677,418 bp
  • A to G, chromosome 2 at 62,234,495 bp
  • A to G, chromosome 2 at 89,993,857 bp
  • A to C, chromosome 2 at 119,752,074 bp
  • A to T, chromosome 2 at 155,210,444 bp
  • T to C, chromosome 2 at 181,670,372 bp
  • T to A, chromosome 3 at 53,537,493 bp
  • T to A, chromosome 3 at 133,132,436 bp
  • T to C, chromosome 4 at 73,790,984 bp
  • T to C, chromosome 5 at 45,523,536 bp
  • G to A, chromosome 5 at 74,628,185 bp
  • T to C, chromosome 5 at 92,964,525 bp
  • C to T, chromosome 6 at 5,969,429 bp
  • A to G, chromosome 6 at 22,123,580 bp
  • T to G, chromosome 6 at 124,870,572 bp
  • A to T, chromosome 6 at 145,169,783 bp
  • T to A, chromosome 7 at 8,378,370 bp
  • G to A, chromosome 7 at 18,480,009 bp
  • T to A, chromosome 7 at 30,868,048 bp
  • G to A, chromosome 7 at 44,191,801 bp
  • A to G, chromosome 7 at 44,710,333 bp
  • C to T, chromosome 7 at 55,800,695 bp
  • T to A, chromosome 7 at 78,250,839 bp
  • T to C, chromosome 7 at 81,973,310 bp
  • T to A, chromosome 7 at 90,176,768 bp
  • T to A, chromosome 7 at 96,895,349 bp
  • ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,713 bp
  • A to G, chromosome 8 at 31,091,719 bp
  • GCCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA to GCCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA, chromosome 8 at 66,860,486 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • T to C, chromosome 8 at 110,089,136 bp
  • T to C, chromosome 8 at 119,600,668 bp
  • C to A, chromosome 8 at 120,085,427 bp
  • T to C, chromosome 9 at 39,597,647 bp
  • A to G, chromosome 9 at 112,183,544 bp
  • A to G, chromosome 10 at 58,479,230 bp
  • G to T, chromosome 10 at 78,587,069 bp
  • A to G, chromosome 10 at 127,177,168 bp
  • G to T, chromosome 11 at 58,919,137 bp
  • T to G, chromosome 11 at 103,117,166 bp
  • T to C, chromosome 11 at 103,503,340 bp
  • A to G, chromosome 12 at 16,723,314 bp
  • A to T, chromosome 12 at 57,239,248 bp
  • A to G, chromosome 12 at 75,943,888 bp
  • A to T, chromosome 12 at 81,560,241 bp
  • A to G, chromosome 12 at 102,788,335 bp
  • A to C, chromosome 13 at 102,737,715 bp
  • T to G, chromosome 14 at 25,651,948 bp
  • G to A, chromosome 14 at 50,299,279 bp
  • C to A, chromosome 15 at 103,482,124 bp
  • T to C, chromosome 16 at 55,818,300 bp
  • T to C, chromosome 16 at 59,110,037 bp
  • T to A, chromosome 17 at 21,560,130 bp
  • G to T, chromosome 17 at 27,560,971 bp
  • T to C, chromosome 17 at 37,406,172 bp
  • T to A, chromosome 17 at 38,130,710 bp
  • T to C, chromosome 18 at 35,734,650 bp
  • T to C, chromosome 18 at 89,090,598 bp
  • A to G, chromosome 19 at 5,463,631 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7083 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045177-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.