Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7088Btlr/Mmmh
Stock Number:
045182-MU
Citation ID:
RRID:MMRRC_045182-MU
Other Names:
R7088 (G1)
Major Collection:

Strain Information

Pax6
Name: paired box 6
Synonyms: Pax-6, Dey, Dickie's small eye, 1500038E17Rik, AEY11, Gsfaey11
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18508
HGNC: HGNC:8620
Homologene: 1212
Gli1
Name: GLI-Kruppel family member GLI1
Synonyms: Zfp-5, Zfp5
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14632
VEGA: 10
HGNC: HGNC:4317
Homologene: 3859
Gcm2
Name: glial cells missing homolog 2
Synonyms: Gcm1-rs2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 107889
VEGA: 13
HGNC: HGNC:4198
Homologene: 3490
Mga
Name: MAX gene associated
Synonyms: Mga, Mad5, C130042M01Rik, D030062C11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 29808
Homologene: 49351
Sash1
Name: SAM and SH3 domain containing 1
Synonyms: A330076K04Rik, 1100001C18Rik, 2500002E12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70097
Homologene: 69182
Nup155
Name: nucleoporin 155
Synonyms: D930027M19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170762
VEGA: 15
HGNC: HGNC:8063
Homologene: 43155
Morf4l1
Name: mortality factor 4 like 1
Synonyms: TEG-189, MRG15, MORFRG15, Tex189
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21761
Homologene: 86043
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 36,269,221 bp
  • A to C, chromosome 1 at 40,726,379 bp
  • T to A, chromosome 1 at 100,160,077 bp
  • C to A, chromosome 1 at 107,524,692 bp
  • T to A, chromosome 1 at 162,968,865 bp
  • GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC to GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC, chromosome 1 at 172,128,583 bp
  • T to G, chromosome 1 at 177,447,254 bp
  • T to C, chromosome 2 at 34,785,699 bp
  • G to A, chromosome 2 at 83,915,727 bp
  • G to A, chromosome 2 at 89,752,099 bp
  • A to G, chromosome 2 at 94,004,752 bp
  • A to G, chromosome 2 at 105,696,408 bp
  • G to T, chromosome 2 at 119,961,936 bp
  • A to T, chromosome 3 at 3,648,125 bp
  • T to C, chromosome 3 at 87,457,834 bp
  • C to A, chromosome 3 at 87,754,638 bp
  • A to G, chromosome 4 at 34,806,796 bp
  • A to T, chromosome 4 at 58,849,766 bp
  • G to T, chromosome 4 at 104,793,343 bp
  • G to T, chromosome 4 at 106,387,546 bp
  • C to T, chromosome 4 at 120,704,399 bp
  • A to G, chromosome 4 at 135,803,278 bp
  • T to C, chromosome 5 at 21,653,392 bp
  • T to A, chromosome 5 at 90,572,750 bp
  • T to C, chromosome 5 at 97,455,675 bp
  • T to A, chromosome 6 at 29,920,533 bp
  • T to A, chromosome 6 at 42,263,265 bp
  • A to G, chromosome 6 at 90,303,240 bp
  • A to T, chromosome 7 at 24,745,133 bp
  • G to T, chromosome 7 at 42,662,672 bp
  • A to G, chromosome 7 at 100,416,181 bp
  • A to T, chromosome 7 at 133,742,688 bp
  • A to T, chromosome 7 at 141,440,487 bp
  • G to T, chromosome 8 at 22,169,866 bp
  • T to C, chromosome 8 at 25,666,034 bp
  • A to G, chromosome 8 at 45,350,545 bp
  • G to A, chromosome 8 at 95,538,105 bp
  • C to A, chromosome 9 at 18,592,680 bp
  • C to A, chromosome 9 at 38,180,452 bp
  • T to A, chromosome 9 at 44,513,386 bp
  • A to G, chromosome 9 at 60,724,355 bp
  • C to A, chromosome 9 at 90,097,380 bp
  • T to A, chromosome 9 at 106,000,686 bp
  • C to T, chromosome 9 at 108,058,536 bp
  • G to A, chromosome 10 at 8,729,717 bp
  • A to G, chromosome 10 at 23,900,747 bp
  • A to G, chromosome 10 at 34,153,889 bp
  • G to A, chromosome 10 at 57,512,092 bp
  • G to T, chromosome 10 at 58,463,906 bp
  • A to C, chromosome 10 at 78,917,759 bp
  • C to A, chromosome 10 at 127,335,999 bp
  • T to C, chromosome 11 at 21,558,484 bp
  • A to T, chromosome 11 at 76,263,148 bp
  • G to T, chromosome 11 at 83,440,406 bp
  • T to C, chromosome 11 at 84,278,957 bp
  • G to T, chromosome 11 at 85,847,036 bp
  • T to A, chromosome 11 at 98,919,239 bp
  • C to T, chromosome 12 at 4,215,307 bp
  • T to A, chromosome 12 at 8,978,659 bp
  • T to A, chromosome 13 at 21,959,992 bp
  • T to G, chromosome 13 at 30,195,789 bp
  • T to C, chromosome 13 at 41,103,364 bp
  • T to C, chromosome 13 at 54,463,752 bp
  • A to T, chromosome 13 at 93,091,864 bp
  • A to T, chromosome 14 at 12,207,365 bp
  • T to A, chromosome 14 at 55,943,816 bp
  • T to C, chromosome 15 at 8,156,693 bp
  • C to T, chromosome 15 at 8,218,947 bp
  • A to G, chromosome 15 at 58,564,050 bp
  • G to A, chromosome 15 at 74,626,144 bp
  • T to A, chromosome 15 at 79,719,282 bp
  • T to A, chromosome 15 at 89,503,525 bp
  • T to A, chromosome 18 at 7,921,455 bp
  • T to C, chromosome 18 at 12,582,545 bp
  • T to C, chromosome 18 at 31,771,819 bp
  • T to C, chromosome 18 at 32,939,531 bp
  • G to A, chromosome 18 at 37,005,417 bp
  • G to T, chromosome 19 at 37,577,010 bp
  • A to G, chromosome 19 at 59,344,957 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7088 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045182-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.