Strain Name:
C57BL/6J-MtgxR7088Btlr/Mmmh
Stock Number:
045182-MU
Citation ID:
RRID:MMRRC_045182-MU
Other Names:
R7088 (G1)
Major Collection:

Strain Information

Pax6
Name: paired box 6
Synonyms: Gsfaey11, AEY11, Dey, 1500038E17Rik, Pax-6, Dickie's small eye
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18508
HGNC: HGNC:8620
Homologene: 1212
Gli1
Name: GLI-Kruppel family member GLI1
Synonyms: Zfp-5, Zfp5
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14632
VEGA: 10
HGNC: HGNC:4317
Homologene: 3859
Gcm2
Name: glial cells missing homolog 2
Synonyms: Gcm1-rs2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 107889
VEGA: 13
HGNC: HGNC:4198
Homologene: 3490
Mga
Name: MAX gene associated
Synonyms: D030062C11Rik, Mad5, C130042M01Rik, Mga
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 29808
Homologene: 49351
Sash1
Name: SAM and SH3 domain containing 1
Synonyms: 1100001C18Rik, A330076K04Rik, 2500002E12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70097
Homologene: 69182
Nup155
Name: nucleoporin 155
Synonyms: D930027M19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170762
VEGA: 15
HGNC: HGNC:8063
Homologene: 43155
Morf4l1
Name: mortality factor 4 like 1
Synonyms: MORFRG15, MRG15, TEG-189, Tex189
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21761
Homologene: 86043
Cdc6
Name: cell division cycle 6
Synonyms: cell division cycle 18 homolog (S.pombe)-like, CDC18L, CDC18(S.pombe)
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23834
HGNC: HGNC:1744
Homologene: 68172
Hsf2
Name: heat shock factor 2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15500
VEGA: 10
HGNC: HGNC:5225
Homologene: 37931
Exoc6
Name: exocyst complex component 6
Synonyms: Sec15, hbd, Sec15l1, 4833405E05Rik, msec15
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107371
VEGA: 19
Homologene: 41305
Wac
Name: WW domain containing adaptor with coiled-coil
Synonyms: Wwp4, 1110067P07Rik, A230035H12Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225131
Homologene: 41148
Ptprg
Name: protein tyrosine phosphatase receptor type G
Synonyms: 5430405N12Rik, RPTPgamma
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19270
HGNC: HGNC:9671
Homologene: 2129
Ranbp2
Name: RAN binding protein 2
Synonyms: A430087B05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19386
VEGA: 10
Homologene: 87808
Zfp292
Name: zinc finger protein 292
Synonyms: Zfp-15, 5730450D02Rik, Zn-16, Zn-15, 9430062L07Rik, Zfp15, Krox-10
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 30046
Homologene: 8493
Usp24
Name: ubiquitin specific peptidase 24
Synonyms: 2810030C21Rik, 2700066K03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329908
Homologene: 35420
Rnf123
Name: ring finger protein 123
Synonyms: KPC1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 84585
Homologene: 11112
C2cd3
Name: C2 calcium-dependent domain containing 3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 277939
Homologene: 19524
Armc10
Name: armadillo repeat containing 10
Synonyms: 2810037C14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67211
Homologene: 12097
Ecpas
Name: Ecm29 proteasome adaptor and scaffold
Synonyms: AI314180
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230249
Homologene: 6056
Mdh1
Name: malate dehydrogenase 1, NAD (soluble)
Synonyms: MDH-s, Mor2, Mor-2, B230377B03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17449
HGNC: HGNC:6970
Homologene: 4324
Acaca
Name: acetyl-Coenzyme A carboxylase alpha
Synonyms: A530025K05Rik, Acac, LOC327983, acetyl-CoA carboxylase, Acc1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 107476
HGNC: HGNC:84
Homologene: 31015
Dhx32
Name: DEAH-box helicase 32 (putative)
Synonyms: DEAH (Asp-Glu-Ala-His) box polypeptide 32, Ddx32
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101437
Homologene: 56798
Zbtb18
Name: zinc finger and BTB domain containing 18
Synonyms: RP58, Zfp238
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 30928
Homologene: 21276
Strip2
Name: striatin interacting protein 2
Synonyms: D330017J20Rik, Myoscape, Fam40b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320609
Homologene: 66198
Fcrl5
Name: Fc receptor-like 5
Synonyms: BXMAS1-like protein 2, mBXMH2, Fcrh3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329693
Homologene: 137404
Muc16
Name: mucin 16
Synonyms: 1110008I14Rik, LOC385009, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Nxn
Name: nucleoredoxin
Synonyms: l11Jus13
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18230
Homologene: 69028
Gtpbp1
Name: GTP binding protein 1
Synonyms: GP-1, GTPBP1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14904
VEGA: 15
HGNC: HGNC:4669
Homologene: 3165
Pex19
Name: peroxisomal biogenesis factor 19
Synonyms: Pxf, peroxisome biogenesis factor 19
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19298
HGNC: HGNC:9713
Homologene: 134253
Ckap2
Name: cytoskeleton associated protein 2
Synonyms: LB1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 80986
HGNC: HGNC:1990
Homologene: 10070
Dse
Name: dermatan sulfate epimerase
Synonyms: B130024B19Rik, Sart2, DS-epi1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 212898
VEGA: 10
Homologene: 8354
Zfp975
Name: zinc finger protein 975
Synonyms: Gm5595
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434179
Homologene: 134004
Tmem139
Name: transmembrane protein 139
Synonyms: A930027H06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 109218
VEGA: 6
Homologene: 51920
Slc9a2
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 2
Synonyms: 4932415O19Rik, 2210416H12Rik, NHE2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226999
Homologene: 20661
C8b
Name: complement component 8, beta polypeptide
Synonyms: 4930439B20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 110382
HGNC: HGNC:1353
Homologene: 48
Cmya5
Name: cardiomyopathy associated 5
Synonyms: Myospryn, 2310076E21Rik, 2310076E16Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76469
VEGA: 13
Homologene: 137367
Lama3
Name: laminin, alpha 3
Synonyms: nicein, 150kDa, [a]3B
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16774
HGNC: HGNC:6483
Homologene: 18279
Vnn1
Name: vanin 1
Synonyms: V-1, pantetheinase
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22361
Homologene: 32130
Fer1l6
Name: fer-1 like family member 6
Synonyms: EG631797
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 631797
Homologene: 53396
Mroh4
Name: maestro heat-like repeat family member 4
Synonyms: 1700016M24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69439
Homologene: 72545
Cplane1
Name: ciliogenesis and planar polarity effector 1
Synonyms: 2410089E03Rik, Jbts17, Hug, b2b012Clo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 73692
Homologene: 11315
Or4a80
Name: olfactory receptor family 4 subfamily A member 80
Synonyms: Olfr1559-ps1, Olfr1253, Olfr1253-ps1, MOR231-18, GA_x6K02T2Q125-51193814-51192857, MOR231-19P, MOR231-19P
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258370
Pdzd8
Name: PDZ domain containing 8
Synonyms: Pdzk8, A630041P07Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107368
VEGA: 19
Homologene: 14879
Cma1
Name: chymase 1, mast cell
Synonyms: Mcp-5, Mcpt5, Mcp5, MMCP-5
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17228
VEGA: 14
HGNC: HGNC:2097
Homologene: 55606
Or8c13
Name: olfactory receptor family 8 subfamily C member 13
Synonyms: MOR170-9, Olfr891, GA_x6K02T2PVTD-31862167-31861217
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258471
Homologene: 74210
Pear1
Name: platelet endothelial aggregation receptor 1
Synonyms: 3110045G13Rik, Jedi-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73182
Homologene: 12492
Kcnq4
Name: potassium voltage-gated channel, subfamily Q, member 4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 60613
HGNC: HGNC:6298
Homologene: 78107
BC048671
Name: cDNA sequence BC048671
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243535
Homologene: 135985
Rabepk
Name: Rab9 effector protein with kelch motifs
Synonyms: 8430412M01Rik, 9530020D24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227746
Homologene: 48772
Col6a4
Name: collagen, type VI, alpha 4
Synonyms: Dvwa, Vwa6, EG235580, 1110001D15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68553
Homologene: 130754
Albfm1
Name: albumin superfamily member 1
Synonyms: 5830473C10Rik, ARG, Gm17754
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 622307
Homologene: 129803
Fam149a
Name: family with sequence similarity 149, member A
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 212326
Homologene: 27540
Hnf4g
Name: hepatocyte nuclear factor 4, gamma
Synonyms: NR2A2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 30942
HGNC: HGNC:5026
Homologene: 37886
Nsd3
Name: nuclear receptor binding SET domain protein 3
Synonyms: WHISTLE, Whsc1l1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234135
Homologene: 56960
Cntnap5b
Name: contactin associated protein-like 5B
Synonyms: C230078M14Rik, Caspr5-2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241175
Homologene: 104295
Mboat1
Name: membrane bound O-acyltransferase domain containing 1
Synonyms: 9130215M02Rik, Oact1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218121
Homologene: 57467
Camk4
Name: calcium/calmodulin-dependent protein kinase IV
Synonyms: A430110E23Rik, CaMKIV/Gr, Ca2+/calmodulin-dependent protein kinase type IV/Gr, D18Bwg0362e, CaMKIV
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12326
VEGA: 18
HGNC: HGNC:1464
Homologene: 100780
Or7a38
Name: olfactory receptor family 7 subfamily A member 38
Synonyms: Olfr233-ps1, Olfr1354, MOR139-5, GA_x6K02T03FR9-4826-3919, MOR139-7, GA_x6K02T2QGN0-2895081-2894349, MOR185-8, EG257869
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 259163
Homologene: 136441
Myom3
Name: myomesin family, member 3
Synonyms: 8430427K15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242702
Homologene: 19432
Shank3
Name: SH3 and multiple ankyrin repeat domains 3
Synonyms: ProSAP2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 58234
Homologene: 75163
Cenpo
Name: centromere protein O
Synonyms: 2810429O05Rik, D12Ertd482e, 8430427C03Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 52504
Homologene: 49760
Cxcr5
Name: C-X-C motif chemokine receptor 5
Synonyms: Gpcr6, Blr1, CXCR-5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12145
VEGA: 9
HGNC: HGNC:1060
Homologene: 1298
Pidd1
Name: p53 induced death domain protein 1
Synonyms: Lrdd, 1200011D09Rik, Pidd
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57913
Homologene: 11220
Wdr35
Name: WD repeat domain 35
Synonyms: 4930459M12Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74682
Homologene: 10814
Zfp184
Name: zinc finger protein 184 (Kruppel-like)
Synonyms: 4930500C15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 193452
Homologene: 113602
Alkbh3
Name: alkB homolog 3, alpha-ketoglutarate-dependent dioxygenase
Synonyms: 1810020C19Rik, 1700108H04Rik, mABH3, Abh3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69113
Homologene: 16393
Cd177
Name: CD177 antigen
Synonyms: Pdp3, 1190003K14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68891
Homologene: 49628
Ammecr1l
Name: AMME chromosomal region gene 1-like
Synonyms: 5430429D03Rik, E230022H04Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225339
VEGA: 18
Homologene: 69488
Fmo3
Name: flavin containing monooxygenase 3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14262
HGNC: HGNC:3771
Homologene: 128199
Zswim2
Name: zinc finger SWIM-type containing 2
Synonyms: 4933437F18Rik, 1700025P14Rik, MEX
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71861
Homologene: 32689
Gk2
Name: glycerol kinase 2
Synonyms: Gk-rs2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14626
HGNC: HGNC:4291
Homologene: 133273
Serpinb2
Name: serine (or cysteine) peptidase inhibitor, clade B, member 2
Synonyms: ovalbumin, PAI-2, Planh2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18788
HGNC: HGNC:8584
Homologene: 20571
Ccdc113
Name: coiled-coil domain containing 113
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244608
Homologene: 40927
Thoc3
Name: THO complex 3
Synonyms: 2410044K02Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 73666
Homologene: 12505
Neurl3
Name: neuralized E3 ubiquitin protein ligase 3
Synonyms: 2010300P06Rik, Lincr
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 214854
Homologene: 35002
1700020L24Rik
Name: RIKEN cDNA 1700020L24 gene
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66330
Homologene: 11949
Gm11444
Name: predicted gene 11444
Type: Gene
Species: Mouse
Chromosome: 11
Larp6
Name: La ribonucleoprotein 6, translational regulator
Synonyms: 5430431G03Rik, Achn, acheron
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67557
Homologene: 32408
Pcdha11
Name: protocadherin alpha 11
Synonyms: Crnr7, Cnr7, A830022B16Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12942
HGNC: HGNC:8665
Homologene: 75095
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 36,269,221 bp
  • A to C, chromosome 1 at 40,726,379 bp
  • T to A, chromosome 1 at 100,160,077 bp
  • C to A, chromosome 1 at 107,524,692 bp
  • T to A, chromosome 1 at 162,968,865 bp
  • GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC to GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC, chromosome 1 at 172,128,583 bp
  • T to G, chromosome 1 at 177,447,254 bp
  • T to C, chromosome 2 at 34,785,699 bp
  • G to A, chromosome 2 at 83,915,727 bp
  • G to A, chromosome 2 at 89,752,099 bp
  • A to G, chromosome 2 at 94,004,752 bp
  • A to G, chromosome 2 at 105,696,408 bp
  • G to T, chromosome 2 at 119,961,936 bp
  • A to T, chromosome 3 at 3,648,125 bp
  • T to C, chromosome 3 at 87,457,834 bp
  • C to A, chromosome 3 at 87,754,638 bp
  • A to G, chromosome 4 at 34,806,796 bp
  • A to T, chromosome 4 at 58,849,766 bp
  • G to T, chromosome 4 at 104,793,343 bp
  • G to T, chromosome 4 at 106,387,546 bp
  • C to T, chromosome 4 at 120,704,399 bp
  • A to G, chromosome 4 at 135,803,278 bp
  • T to C, chromosome 5 at 21,653,392 bp
  • T to A, chromosome 5 at 90,572,750 bp
  • T to C, chromosome 5 at 97,455,675 bp
  • T to A, chromosome 6 at 29,920,533 bp
  • T to A, chromosome 6 at 42,263,265 bp
  • A to G, chromosome 6 at 90,303,240 bp
  • A to T, chromosome 7 at 24,745,133 bp
  • G to T, chromosome 7 at 42,662,672 bp
  • A to G, chromosome 7 at 100,416,181 bp
  • A to T, chromosome 7 at 133,742,688 bp
  • A to T, chromosome 7 at 141,440,487 bp
  • G to T, chromosome 8 at 22,169,866 bp
  • T to C, chromosome 8 at 25,666,034 bp
  • A to G, chromosome 8 at 45,350,545 bp
  • G to A, chromosome 8 at 95,538,105 bp
  • C to A, chromosome 9 at 18,592,680 bp
  • C to A, chromosome 9 at 38,180,452 bp
  • T to A, chromosome 9 at 44,513,386 bp
  • A to G, chromosome 9 at 60,724,355 bp
  • C to A, chromosome 9 at 90,097,380 bp
  • T to A, chromosome 9 at 106,000,686 bp
  • C to T, chromosome 9 at 108,058,536 bp
  • G to A, chromosome 10 at 8,729,717 bp
  • A to G, chromosome 10 at 23,900,747 bp
  • A to G, chromosome 10 at 34,153,889 bp
  • G to A, chromosome 10 at 57,512,092 bp
  • G to T, chromosome 10 at 58,463,906 bp
  • A to C, chromosome 10 at 78,917,759 bp
  • C to A, chromosome 10 at 127,335,999 bp
  • T to C, chromosome 11 at 21,558,484 bp
  • A to T, chromosome 11 at 76,263,148 bp
  • G to T, chromosome 11 at 83,440,406 bp
  • T to C, chromosome 11 at 84,278,957 bp
  • G to T, chromosome 11 at 85,847,036 bp
  • T to A, chromosome 11 at 98,919,239 bp
  • C to T, chromosome 12 at 4,215,307 bp
  • T to A, chromosome 12 at 8,978,659 bp
  • T to A, chromosome 13 at 21,959,992 bp
  • T to G, chromosome 13 at 30,195,789 bp
  • T to C, chromosome 13 at 41,103,364 bp
  • T to C, chromosome 13 at 54,463,752 bp
  • A to T, chromosome 13 at 93,091,864 bp
  • A to T, chromosome 14 at 12,207,365 bp
  • T to A, chromosome 14 at 55,943,816 bp
  • T to C, chromosome 15 at 8,156,693 bp
  • C to T, chromosome 15 at 8,218,947 bp
  • A to G, chromosome 15 at 58,564,050 bp
  • G to A, chromosome 15 at 74,626,144 bp
  • T to A, chromosome 15 at 79,719,282 bp
  • T to A, chromosome 15 at 89,503,525 bp
  • T to A, chromosome 18 at 7,921,455 bp
  • T to C, chromosome 18 at 12,582,545 bp
  • T to C, chromosome 18 at 31,771,819 bp
  • T to C, chromosome 18 at 32,939,531 bp
  • G to A, chromosome 18 at 37,005,417 bp
  • G to T, chromosome 19 at 37,577,010 bp
  • A to G, chromosome 19 at 59,344,957 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7088 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045182-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.