Strain Name:
C57BL/6J-MtgxR7117Btlr/Mmmh
Stock Number:
045208-MU
Citation ID:
RRID:MMRRC_045208-MU
Other Names:
R7117 (G1)
Major Collection:

Strain Information

Kit
Name: KIT proto-oncogene receptor tyrosine kinase
Synonyms: Steel Factor Receptor, c-KIT, Dominant white spotting, Tr-kit, belly-spot, SCO1, SOW3, SCO5, Gsfsow3, Gsfsco5, Gsfsco1, CD117
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16590
HGNC: HGNC:6342
Homologene: 187
Kera
Name: keratocan
Synonyms: SLRR2B, CNA2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16545
VEGA: 10
HGNC: HGNC:6309
Homologene: 5106
Phf21a
Name: PHD finger protein 21A
Synonyms: 80kDa, Braf35/HDAC complex (Bhc), PFTF1, Bhc80, D030065N23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 192285
Homologene: 9597
Cers2
Name: ceramide synthase 2
Synonyms: Trh3, 0610013I17Rik, CerS2, Lass2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76893
Homologene: 39581
Col6a1
Name: collagen, type VI, alpha 1
Synonyms: Col6a-1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12833
HGNC: HGNC:2211
Homologene: 1391
Usp1
Name: ubiquitin specific peptidase 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230484
Homologene: 2528
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, C130061D10Rik, Phr1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105689
Homologene: 9005
Thada
Name: thyroid adenoma associated
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240174
VEGA: 17
Homologene: 75175
Flnb
Name: filamin, beta
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 286940
HGNC: HGNC:3755
Homologene: 37480
Tex2
Name: testis expressed gene 2
Synonyms: Taz4, Def-5, 4930568E07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21763
Homologene: 32414
Prmt3
Name: protein arginine N-methyltransferase 3
Synonyms: 2410018A17Rik, 2010005E20Rik, Hrmt1l3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71974
Homologene: 24255
Ccdc18
Name: coiled-coil domain containing 18
Synonyms: 1700021E15Rik, 4932411G06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 73254
Homologene: 35455
Stip1
Name: stress-induced phosphoprotein 1
Synonyms: p60, IEF SSP 3521, Hop, Hsp70/Hsp90 organizing protein, STI1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20867
VEGA: 19
Homologene: 4965
Csf2rb2
Name: colony stimulating factor 2 receptor, beta 2, low-affinity (granulocyte-macrophage)
Synonyms: AIC2A, Il3rb2, Il3r, Bil3, BetaIl3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12984
VEGA: 15
HGNC: HGNC:2436
Homologene: 339
Sez6l2
Name: seizure related 6 homolog like 2
Synonyms: Psk1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233878
Homologene: 8237
Kcnh5
Name: potassium voltage-gated channel, subfamily H (eag-related), member 5
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238271
VEGA: 12
HGNC: HGNC:6254
Homologene: 15858
Peg3
Name: paternally expressed 3
Synonyms: Pw1, Zfp102, End4, Gcap4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18616
HGNC: HGNC:8826
Homologene: 31363
Tsr1
Name: TSR1 20S rRNA accumulation
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 104662
Homologene: 5576
Sox2
Name: SRY (sex determining region Y)-box 2
Synonyms: Sox-2, lcc, ysb
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20674
Homologene: 68298
Adam12
Name: ADAM metallopeptidase domain 12
Synonyms: Mltna, ADAM12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11489
HGNC: HGNC:190
Homologene: 74862
Zfp68
Name: zinc finger protein 68
Synonyms: KRAZ2, Zfp68, KRAB3, Zfp70
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 24135
Homologene: 56605
Rac3
Name: Rac family small GTPase 3
Synonyms: Rac1B
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 170758
HGNC: HGNC:9803
Homologene: 68433
C3
Name: complement component 3
Synonyms: complement factor 3, acylation stimulating protein, Plp
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12266
HGNC: HGNC:1318
Homologene: 68031
Sidt2
Name: SID1 transmembrane family, member 2
Synonyms: CGI-40
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214597
Homologene: 22943
Galnt14
Name: polypeptide N-acetylgalactosaminyltransferase 14
Synonyms: 0610033M06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71685
Homologene: 56997
Fat1
Name: FAT atypical cadherin 1
Synonyms: mFat1, 2310038E12Rik, Fath
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14107
HGNC: HGNC:3595
Homologene: 66302
2900026A02Rik
Name: RIKEN cDNA 2900026A02 gene
Synonyms: LOC231620, Gm449
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243219
Homologene: 129566
Mtus1
Name: mitochondrial tumor suppressor 1
Synonyms: MD44, MTSG1, Atip1, B430305I03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102103
Homologene: 100292
Baz2b
Name: bromodomain adjacent to zinc finger domain, 2B
Synonyms: D2Ertd794e, 5830435C13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 407823
HGNC: HGNC:963
Homologene: 8394
Zswim4
Name: zinc finger SWIM-type containing 4
Synonyms: E130119J17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 212168
Homologene: 18183
Pax1
Name: paired box 1
Synonyms: wt, hbs, Pax-1, hunchback, wavy tail
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18503
HGNC: HGNC:8615
Homologene: 4514
Hjv
Name: hemojuvelin BMP co-receptor
Synonyms: 2310035L15Rik, 5230400G09Rik, DL-M, Rgmc, HJV, hemojuvelin, Hfe2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69585
HGNC: HGNC:4887
Homologene: 17060
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Vwa3b
Name: von Willebrand factor A domain containing 3B
Synonyms: A230074B11Rik, 4921511C04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70853
Homologene: 27053
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Uggt2
Name: UDP-glucose glycoprotein glucosyltransferase 2
Synonyms: 3110001A05Rik, 1810064L21Rik, 3110027P15Rik, A230065J02Rik, Ugcgl2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66435
Homologene: 56875
Cited2
Name: Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2
Synonyms: Mrg1, p35srj, Msg2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17684
VEGA: 10
HGNC: HGNC:1987
Homologene: 4433
Unc13b
Name: unc-13 homolog B
Synonyms: Unc13h2, Munc13-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22249
Homologene: 31376
Ttc8
Name: tetratricopeptide repeat domain 8
Synonyms: 0610012F22Rik, BBS8
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76260
Homologene: 14988
Fat2
Name: FAT atypical cadherin 2
Synonyms: LOC245827, mKIAA0811, Fath2, EMI2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Col28a1
Name: collagen, type XXVIII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 213945
Homologene: 66345
Or51a6
Name: olfactory receptor family 51 subfamily A member 6
Synonyms: GA_x6K02T2PBJ9-5666843-5665908, MOR8-1, Olfr575
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259118
Homologene: 122786
Grk2
Name: G protein-coupled receptor kinase 2
Synonyms: beta ARK, beta ARK1, beta-AR kinase-1, beta-adrenergic receptor kinase-1, Bark-1, Adrbk-1, betaARK1, Adrbk1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 110355
HGNC: HGNC:289
Homologene: 1223
Mob3b
Name: MOB kinase activator 3B
Synonyms: MOB3B, A430018A01Rik, 8430436F23Rik, Mobkl2b
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 214944
Homologene: 69385
Cpne2
Name: copine II
Synonyms: 3322401K10Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234577
HGNC: HGNC:2315
Homologene: 27392
Mtpap
Name: mitochondrial poly(A) polymerase
Synonyms: 0610027A18Rik, Papd1, Tent6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67440
VEGA: 18
Homologene: 10008
Plcb3
Name: phospholipase C, beta 3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18797
VEGA: 19
HGNC: HGNC:9056
Homologene: 47960
Nxpe5
Name: neurexophilin and PC-esterase domain family, member 5
Synonyms: Fam55 related, BC055004
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381680
Homologene: 134143
Pnp2
Name: purine-nucleoside phosphorylase 2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 667034
HGNC: HGNC:7892
Homologene: 227
Morc2b
Name: microrchidia 2B
Synonyms: 4932411A10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240069
Homologene: 18615
Arhgef10l
Name: Rho guanine nucleotide exchange factor 10-like
Synonyms: 2810441C07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72754
Homologene: 10017
Elapor2
Name: endosome-lysosome associated apoptosis and autophagy regulator family member 2
Synonyms: 9330182L06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231014
Homologene: 27396
Btn1a1
Name: butyrophilin, subfamily 1, member A1
Synonyms: Btn
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12231
HGNC: HGNC:1135
Homologene: 1312
Ildr2
Name: immunoglobulin-like domain containing receptor 2
Synonyms: 3110063L10Rik, 2810478N18Rik, OTTMUSG00000021748, ENSMUSG00000040612, Dbsm1, D1Ertd471e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100039795
Homologene: 52388
Adam39
Name: a disintegrin and metallopeptidase domain 39
Synonyms: 1700056P18Rik, testase 9
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 546055
HGNC: HGNC:199
Homologene: 128364
Pam
Name: peptidylglycine alpha-amidating monooxygenase
Synonyms: PHM
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18484
HGNC: HGNC:8596
Homologene: 37369
Spmap2
Name: sperm microtubule associated protein 2
Synonyms: Theg
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21830
Homologene: 7976
Bnc1
Name: basonuclin zinc finger protein 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12173
HGNC: HGNC:1081
Homologene: 31048
Shank1
Name: SH3 and multiple ankyrin repeat domains 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243961
Homologene: 22949
Spef2
Name: sperm flagellar 2
Synonyms: C230086A09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320277
Homologene: 23371
Keg1
Name: kidney expressed gene 1
Synonyms: GS4059, 0610008P16Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 64697
Homologene: 69461
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: LOC227058, Dnahc7b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227058
Homologene: 41287
Megf6
Name: multiple EGF-like-domains 6
Synonyms: 2600001P17Rik, Egfl3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230971
HGNC: HGNC:3232
Homologene: 45412
Papolg
Name: poly(A) polymerase gamma
Synonyms: 9630006B20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216578
Homologene: 56959
Rwdd3
Name: RWD domain containing 3
Synonyms: 3110037C01Rik, 2510027J23Rik, RSUME
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66568
Homologene: 22899
Zmynd10
Name: zinc finger, MYND domain containing 10
Synonyms: Blu
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 114602
Homologene: 9293
Bscl2
Name: BSCL2 lipid droplet biogenesis associated, seipin
Synonyms: seipin, Gng3lg
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14705
Homologene: 32032
Mettl21c
Name: methyltransferase 21C, AARS1 lysine
Synonyms: A530098C11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 433294
Homologene: 45916
Defb25
Name: defensin beta 25
Synonyms: OTTMUSG00000015862
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 654459
Homologene: 134597
Raly
Name: hnRNP-associated with lethal yellow
Synonyms: Merc
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19383
Homologene: 7216
Osbpl5
Name: oxysterol binding protein-like 5
Synonyms: Obph1, ORP5, 1110006M06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 79196
Homologene: 98024
Cntn5
Name: contactin 5
Synonyms: LOC244683, NB-2, A830025P08Rik, 6720426O10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244682
HGNC: HGNC:2175
Homologene: 28447
Pde11a
Name: phosphodiesterase 11A
Synonyms: A630086N24Rik, 6330414F14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241489
HGNC: HGNC:8773
Homologene: 56763
Rbm20
Name: RNA binding motif protein 20
Synonyms: 2010003H22Rik, 1110018J23Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73713
Homologene: 28386
Cr2
Name: complement receptor 2
Synonyms: CD21, CD35, Cr-1, Cr-2, Cr1, C3DR
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12902
HGNC: HGNC:2336
Homologene: 55611
Fam178b
Name: family with sequence similarity 178, member B
Synonyms: LOC381337, 1700024G10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381337
Homologene: 87288
Hectd2
Name: HECT domain E3 ubiquitin protein ligase 2
Synonyms: A630025O09Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226098
Homologene: 6280
Extl2
Name: exostosin-like glycosyltransferase 2
Synonyms: 3000001D04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 58193
HGNC: HGNC:3516
Homologene: 1102
Zfp28
Name: zinc finger protein 28
Synonyms: mkr-5, Zfp-28, 2810438M17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22690
Homologene: 69047
Fam186b
Name: family with sequence similarity 186, member B
Synonyms: EG545136
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 545136
VEGA: 15
Homologene: 69502
Oxnad1
Name: oxidoreductase NAD-binding domain containing 1
Synonyms: 2410002F01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218885
Homologene: 16303
Dvl3
Name: dishevelled segment polarity protein 3
Synonyms: b2b2866Clo
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13544
HGNC: HGNC:3087
Homologene: 20928
Pou5f2
Name: POU domain class 5, transcription factor 2
Synonyms: 1700013G10Rik, Sprm1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75507
Homologene: 83454
Ak5
Name: adenylate kinase 5
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229949
HGNC: HGNC:365
Homologene: 76103
Insm2
Name: insulinoma-associated 2
Synonyms: mlt 1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56856
VEGA: 12
Homologene: 10651
Arhgef37
Name: Rho guanine nucleotide exchange factor 37
Synonyms: 4933429F08Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 328967
VEGA: 18
Homologene: 28467
Gpr137c
Name: G protein-coupled receptor 137C
Synonyms: LOC380893, TM7SF1L2, 6330416L11Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70713
Homologene: 28613
Chpt1
Name: choline phosphotransferase 1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 212862
Homologene: 69297
Mfsd1
Name: major facilitator superfamily domain containing 1
Synonyms: 1200003O06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66868
Homologene: 11228
Slc35f6
Name: solute carrier family 35, member F6
Synonyms: 5730478O19Rik, p40, Tango9, 4930471M23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74919
Homologene: 9896
Serpina3a
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3A
Synonyms: 4933406L18Rik, antitrypsin, alpha-1 antiproteinase,
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74069
HGNC: HGNC:16
Tada2a
Name: transcriptional adaptor 2A
Synonyms: D030022J10Rik, Tada2l
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217031
Homologene: 38834
Tmed1
Name: transmembrane p24 trafficking protein 1
Synonyms: St2l, Ly84l, Il1rl1l
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17083
VEGA: 9
Homologene: 21360
Ndufb7
Name: NADH:ubiquinone oxidoreductase subunit B7
Synonyms: 1110002H15Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66916
HGNC: HGNC:7702
Homologene: 3059
4930480E11Rik
Name: RIKEN cDNA 4930480E11 gene
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 74910
Homologene: 136363
Or5d3
Name: olfactory receptor family 5 subfamily D member 3, pseudogene 1
Synonyms: GA_x6K02T2Q125-49829472-49828534, MOR174-19, Olfr1177, Olfr1177-ps
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 545443
HGNC: HGNC:8336
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 36,600,467 bp
  • A to G, chromosome 1 at 37,135,553 bp
  • G to A, chromosome 1 at 44,010,648 bp
  • A to T, chromosome 1 at 46,352,813 bp
  • C to A, chromosome 1 at 97,977,116 bp
  • G to T, chromosome 1 at 166,295,811 bp
  • A to T, chromosome 1 at 195,160,601 bp
  • A to G, chromosome 2 at 59,912,497 bp
  • A to T, chromosome 2 at 76,076,004 bp
  • G to T, chromosome 2 at 76,721,909 bp
  • A to G, chromosome 2 at 76,748,175 bp
  • A to G, chromosome 2 at 76,942,891 bp
  • A to G, chromosome 2 at 88,344,561 bp
  • A to T, chromosome 2 at 92,359,157 bp
  • G to A, chromosome 2 at 147,366,270 bp
  • A to C, chromosome 2 at 152,622,460 bp
  • G to T, chromosome 2 at 154,857,512 bp
  • G to A, chromosome 3 at 34,650,926 bp
  • T to A, chromosome 3 at 67,600,058 bp
  • T to C, chromosome 3 at 95,320,761 bp
  • G to T, chromosome 3 at 96,528,226 bp
  • T to C, chromosome 3 at 116,027,439 bp
  • A to G, chromosome 3 at 121,171,338 bp
  • A to G, chromosome 3 at 152,615,856 bp
  • A to G, chromosome 4 at 34,985,914 bp
  • T to C, chromosome 4 at 43,216,544 bp
  • T to A, chromosome 4 at 88,628,958 bp
  • G to T, chromosome 4 at 98,928,890 bp
  • C to T, chromosome 4 at 140,564,186 bp
  • A to G, chromosome 4 at 154,258,922 bp
  • T to A, chromosome 5 at 9,445,384 bp
  • T to C, chromosome 5 at 30,657,707 bp
  • T to A, chromosome 5 at 75,607,098 bp
  • T to G, chromosome 5 at 108,148,969 bp
  • T to C, chromosome 5 at 113,191,384 bp
  • A to G, chromosome 5 at 138,239,442 bp
  • T to C, chromosome 5 at 138,606,318 bp
  • A to G, chromosome 6 at 8,013,122 bp
  • G to A, chromosome 7 at 6,394,462 bp
  • GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC to GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC, chromosome 7 at 6,709,168 bp
  • C to T, chromosome 7 at 44,327,161 bp
  • G to T, chromosome 7 at 49,818,095 bp
  • G to T, chromosome 7 at 81,973,361 bp
  • T to A, chromosome 7 at 102,954,978 bp
  • A to C, chromosome 7 at 126,953,743 bp
  • T to C, chromosome 7 at 133,916,462 bp
  • T to A, chromosome 7 at 141,813,822 bp
  • T to A, chromosome 7 at 143,709,783 bp
  • G to T, chromosome 8 at 40,826,242 bp
  • A to G, chromosome 8 at 41,083,584 bp
  • A to T, chromosome 8 at 45,031,468 bp
  • T to A, chromosome 8 at 83,570,861 bp
  • C to T, chromosome 8 at 84,214,052 bp
  • T to A, chromosome 8 at 94,555,544 bp
  • T to A, chromosome 9 at 10,904,699 bp
  • G to A, chromosome 9 at 21,509,254 bp
  • C to T, chromosome 9 at 45,953,219 bp
  • A to C, chromosome 9 at 107,547,517 bp
  • A to G, chromosome 10 at 17,724,616 bp
  • T to C, chromosome 10 at 76,725,009 bp
  • A to T, chromosome 10 at 79,584,907 bp
  • T to A, chromosome 10 at 88,480,849 bp
  • A to T, chromosome 10 at 97,612,852 bp
  • T to C, chromosome 11 at 23,895,207 bp
  • A to G, chromosome 11 at 55,281,262 bp
  • G to T, chromosome 11 at 74,899,534 bp
  • T to A, chromosome 11 at 84,085,688 bp
  • A to G, chromosome 11 at 106,544,245 bp
  • A to T, chromosome 11 at 120,723,517 bp
  • C to A, chromosome 12 at 55,600,572 bp
  • T to A, chromosome 12 at 75,114,445 bp
  • T to C, chromosome 12 at 98,976,502 bp
  • C to T, chromosome 12 at 104,116,177 bp
  • A to C, chromosome 13 at 23,459,245 bp
  • A to G, chromosome 13 at 78,025,273 bp
  • T to A, chromosome 14 at 7,894,214 bp
  • A to T, chromosome 14 at 32,091,651 bp
  • A to C, chromosome 14 at 45,279,027 bp
  • T to C, chromosome 14 at 50,964,474 bp
  • A to C, chromosome 14 at 103,154,077 bp
  • T to C, chromosome 14 at 119,014,526 bp
  • G to A, chromosome 15 at 9,729,838 bp
  • T to C, chromosome 15 at 78,285,185 bp
  • A to G, chromosome 15 at 99,285,590 bp
  • T to A, chromosome 16 at 20,527,322 bp
  • T to A, chromosome 17 at 33,137,952 bp
  • A to T, chromosome 17 at 57,212,655 bp
  • T to C, chromosome 17 at 73,494,195 bp
  • C to A, chromosome 17 at 84,230,786 bp
  • T to C, chromosome 18 at 4,380,889 bp
  • C to T, chromosome 18 at 61,504,410 bp
  • A to G, chromosome 19 at 4,290,602 bp
  • A to G, chromosome 19 at 6,964,378 bp
  • C to T, chromosome 19 at 7,021,810 bp
  • G to A, chromosome 19 at 8,848,514 bp
  • T to A, chromosome 19 at 12,709,678 bp
  • A to T, chromosome 19 at 36,599,655 bp
  • A to T, chromosome 19 at 53,851,558 bp
  • G to T, chromosome X at 78,370,705 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7117 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045208-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.