Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7132Btlr/Mmmh
Stock Number:
045217-MU
Citation ID:
RRID:MMRRC_045217-MU
Other Names:
R7132 (G1)
Major Collection:

Strain Information

Fgb
Name: fibrinogen beta chain
Synonyms: 2510049G14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 110135
HGNC: HGNC:3662
Homologene: 3772
Limch1
Name: LIM and calponin homology domains 1
Synonyms: 3732412D22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77569
Homologene: 18953
App
Name: amyloid beta precursor protein
Synonyms: betaAPP, Abeta, protease nexin II, Adap, Cvap, appican, E030013M08Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11820
VEGA: 16
HGNC: HGNC:620
Homologene: 56379
Kdm5b
Name: lysine demethylase 5B
Synonyms: PLU-1, 2010009J12Rik, Plu1, Rb-Bp2, 2210016I17Rik, D1Ertd202e, Jarid1b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75605
Homologene: 48448
Gdf3
Name: growth differentiation factor 3
Synonyms: Gdf-3, Vgr-2, Vgr2, ecat9
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14562
HGNC: HGNC:4218
Homologene: 7336
Ankrd12
Name: ankyrin repeat domain 12
Synonyms: ANCO-2, GAC-1, 2900001A12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106585
Homologene: 9059
Rev1
Name: REV1, DNA directed polymerase
Synonyms: REV1, 1110027I23Rik, Rev1l
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56210
Homologene: 32309
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 6,859,127 bp
  • G to T, chromosome 1 at 38,071,449 bp
  • G to A, chromosome 1 at 57,967,578 bp
  • A to G, chromosome 1 at 65,322,066 bp
  • A to G, chromosome 1 at 107,276,951 bp
  • A to G, chromosome 1 at 134,599,106 bp
  • A to T, chromosome 1 at 162,681,281 bp
  • A to G, chromosome 2 at 25,616,530 bp
  • T to G, chromosome 2 at 65,133,768 bp
  • T to A, chromosome 2 at 76,745,699 bp
  • G to T, chromosome 2 at 76,944,352 bp
  • A to T, chromosome 2 at 120,679,378 bp
  • T to C, chromosome 2 at 130,232,409 bp
  • A to T, chromosome 2 at 132,879,693 bp
  • A to T, chromosome 2 at 146,109,950 bp
  • A to T, chromosome 2 at 156,045,626 bp
  • T to A, chromosome 2 at 178,486,762 bp
  • G to A, chromosome 3 at 83,046,746 bp
  • T to A, chromosome 3 at 152,232,024 bp
  • T to C, chromosome 4 at 43,215,757 bp
  • T to C, chromosome 4 at 43,452,444 bp
  • T to C, chromosome 4 at 45,342,391 bp
  • T to C, chromosome 5 at 66,953,685 bp
  • A to G, chromosome 5 at 130,014,702 bp
  • A to G, chromosome 5 at 136,123,275 bp
  • T to C, chromosome 5 at 136,995,117 bp
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp
  • A to T, chromosome 6 at 30,815,996 bp
  • A to C, chromosome 6 at 122,606,324 bp
  • T to C, chromosome 6 at 136,821,542 bp
  • G to A, chromosome 7 at 4,784,225 bp
  • A to T, chromosome 7 at 27,132,568 bp
  • C to T, chromosome 7 at 110,054,047 bp
  • A to G, chromosome 7 at 131,555,916 bp
  • C to T, chromosome 7 at 141,463,738 bp
  • T to C, chromosome 7 at 141,619,565 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • T to A, chromosome 9 at 108,949,468 bp
  • T to C, chromosome 9 at 110,622,261 bp
  • A to G, chromosome 9 at 120,561,020 bp
  • G to A, chromosome 10 at 5,243,180 bp
  • C to T, chromosome 10 at 69,989,914 bp
  • A to T, chromosome 11 at 28,339,330 bp
  • A to T, chromosome 11 at 51,715,136 bp
  • T to A, chromosome 11 at 72,051,276 bp
  • T to C, chromosome 11 at 72,917,871 bp
  • A to T, chromosome 11 at 73,111,358 bp
  • G to T, chromosome 11 at 86,217,754 bp
  • A to G, chromosome 11 at 101,261,200 bp
  • A to G, chromosome 11 at 119,023,121 bp
  • T to A, chromosome 12 at 110,915,372 bp
  • C to A, chromosome 13 at 67,199,166 bp
  • A to G, chromosome 14 at 34,577,035 bp
  • G to A, chromosome 14 at 46,853,864 bp
  • TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG to TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG, chromosome 15 at 5,098,691 bp
  • A to T, chromosome 15 at 96,350,013 bp
  • A to G, chromosome 16 at 4,055,829 bp
  • A to G, chromosome 16 at 34,256,227 bp
  • T to C, chromosome 16 at 85,056,482 bp
  • C to T, chromosome 17 at 7,344,952 bp
  • T to C, chromosome 17 at 22,454,663 bp
  • A to T, chromosome 17 at 33,241,615 bp
  • T to C, chromosome 17 at 36,260,655 bp
  • C to A, chromosome 17 at 65,983,247 bp
  • A to C, chromosome 18 at 37,687,377 bp
  • A to T, chromosome 18 at 64,340,912 bp
  • A to G, chromosome 18 at 64,507,770 bp
  • A to T, chromosome 18 at 65,698,409 bp
  • T to A, chromosome 19 at 5,569,384 bp
  • C to T, chromosome 19 at 7,021,810 bp
  • G to T, chromosome 19 at 8,941,028 bp
  • T to A, chromosome 19 at 13,815,422 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7132 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045217-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.