Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7169Btlr/Mmmh
Stock Number:
045229-MU
Citation ID:
RRID:MMRRC_045229-MU
Other Names:
R7169 (G1)
Major Collection:

Strain Information

Vldlr
Name: very low density lipoprotein receptor
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 22359
Homologene: 443
Icos
Name: inducible T cell co-stimulator
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 54167
HGNC: HGNC:5351
Homologene: 8097
Lrrn1
Name: leucine rich repeat protein 1, neuronal
Synonyms: NLRR-1, 2810047E21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16979
Homologene: 32036
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, C130061D10Rik, Phr1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105689
Homologene: 9005
Csnk2a2
Name: casein kinase 2, alpha prime polypeptide
Synonyms: CK2, 1110035J23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13000
HGNC: HGNC:2459
Homologene: 20444
Zfhx3
Name: zinc finger homeobox 3
Synonyms: WBP9, A230102L03Rik, Atbf1, Sci
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11906
HGNC: HGNC:777
Homologene: 21366
Ilf3
Name: interleukin enhancer binding factor 3
Synonyms: NF90
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 16201
VEGA: 9
HGNC: HGNC:6038
Homologene: 7785
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 5,589,081 bp
  • T to C, chromosome 1 at 40,293,359 bp
  • A to G, chromosome 1 at 60,995,546 bp
  • G to A, chromosome 1 at 104,947,353 bp
  • A to T, chromosome 1 at 105,844,695 bp
  • G to A, chromosome 1 at 166,307,934 bp
  • G to T, chromosome 1 at 181,702,365 bp
  • G to A, chromosome 2 at 25,458,719 bp
  • A to T, chromosome 2 at 84,702,331 bp
  • T to C, chromosome 2 at 91,118,179 bp
  • T to A, chromosome 2 at 111,328,598 bp
  • A to G, chromosome 2 at 111,912,594 bp
  • T to A, chromosome 2 at 151,594,387 bp
  • C to T, chromosome 2 at 165,352,439 bp
  • A to T, chromosome 2 at 168,211,423 bp
  • G to T, chromosome 3 at 52,989,966 bp
  • A to G, chromosome 3 at 87,727,448 bp
  • A to G, chromosome 3 at 87,808,594 bp
  • A to T, chromosome 3 at 94,389,180 bp
  • C to T, chromosome 3 at 103,744,217 bp
  • A to T, chromosome 3 at 130,620,696 bp
  • T to A, chromosome 4 at 106,691,639 bp
  • T to G, chromosome 4 at 121,416,751 bp
  • T to A, chromosome 5 at 115,240,228 bp
  • T to C, chromosome 6 at 50,227,378 bp
  • T to A, chromosome 6 at 69,823,535 bp
  • A to T, chromosome 6 at 73,038,746 bp
  • T to C, chromosome 6 at 107,567,604 bp
  • C to A, chromosome 6 at 108,065,088 bp
  • G to T, chromosome 6 at 116,494,064 bp
  • T to C, chromosome 7 at 4,715,404 bp
  • C to T, chromosome 7 at 45,686,774 bp
  • G to A, chromosome 7 at 85,858,455 bp
  • T to C, chromosome 7 at 105,091,190 bp
  • A to G, chromosome 7 at 109,455,121 bp
  • CAGCATCTGCTCGGAGCA to CAGCA, chromosome 8 at 26,160,856 bp
  • A to T, chromosome 8 at 45,397,019 bp
  • T to G, chromosome 8 at 70,617,787 bp
  • A to G, chromosome 8 at 95,488,378 bp
  • T to A, chromosome 8 at 108,951,398 bp
  • T to A, chromosome 8 at 117,040,835 bp
  • T to A, chromosome 9 at 20,875,179 bp
  • T to A, chromosome 9 at 21,395,426 bp
  • A to G, chromosome 9 at 59,671,625 bp
  • A to G, chromosome 9 at 88,398,309 bp
  • T to G, chromosome 10 at 21,055,019 bp
  • A to T, chromosome 10 at 23,155,947 bp
  • T to A, chromosome 10 at 34,092,164 bp
  • A to G, chromosome 10 at 61,204,928 bp
  • T to C, chromosome 10 at 82,110,459 bp
  • T to C, chromosome 10 at 84,374,745 bp
  • A to G, chromosome 12 at 12,359,232 bp
  • A to G, chromosome 12 at 14,150,618 bp
  • G to A, chromosome 13 at 73,784,560 bp
  • C to G, chromosome 14 at 55,720,901 bp
  • A to G, chromosome 14 at 103,260,200 bp
  • C to A, chromosome 15 at 75,044,646 bp
  • C to A, chromosome 15 at 76,105,914 bp
  • A to T, chromosome 15 at 89,188,852 bp
  • CACTACATACTACATACTACATACTACATACTACATACTACATAC to CACTACATACTACATACTACATACTACATACTACATACTACATACTACATAC, chromosome 15 at 98,909,158 bp
  • ACTACAT to ACTACATGCTACAT, chromosome 15 at 98,909,194 bp
  • A to G, chromosome 16 at 31,880,162 bp
  • T to C, chromosome 17 at 35,929,473 bp
  • G to A, chromosome 17 at 44,085,264 bp
  • T to C, chromosome 18 at 75,472,016 bp
  • T to A, chromosome 18 at 76,860,986 bp
  • A to G, chromosome 19 at 8,933,464 bp
  • G to A, chromosome 19 at 27,244,328 bp
  • A to G, chromosome X at 112,644,345 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7169 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045229-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.