Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7180Btlr/Mmmh
Stock Number:
045233-MU
Citation ID:
RRID:MMRRC_045233-MU
Other Names:
R7180 (G1)
Major Collection:

Strain Information

Myh9
Name: myosin, heavy polypeptide 9, non-muscle
Synonyms: D0Jmb2, E030044M24Rik, NMHC II-A, Myhn-1, Myhn1, myosin IIA, Fltn
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17886
HGNC: HGNC:7579
Homologene: 129835
Hdgfl2
Name: HDGF like 2
Synonyms: HRP-2, Hdgfrp2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15193
VEGA: 17
Homologene: 7355
P2rx7
Name: purinergic receptor P2X, ligand-gated ion channel, 7
Synonyms: P2X7 receptor, P2X7R, P2X(7)
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18439
HGNC: HGNC:8537
Homologene: 1925
Magi1
Name: membrane associated guanylate kinase, WW and PDZ domain containing 1
Synonyms: WWP3, Gukmi1, AIP3, BAP1, Baiap1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14924
HGNC: HGNC:946
Homologene: 31257
Slc4a7
Name: solute carrier family 4, sodium bicarbonate cotransporter, member 7
Synonyms: E430014N10Rik, NBC3, NBCn1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218756
VEGA: 14
Homologene: 2680
Eps8
Name: epidermal growth factor receptor pathway substrate 8
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13860
HGNC: HGNC:3420
Homologene: 3272
Pdzd2
Name: PDZ domain containing 2
Synonyms: 4930537L06Rik, LOC223364, A930022H17Rik, Pdzk3, Gm21706
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68070
Homologene: 23393
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 38,049,074 bp
  • A to T, chromosome 1 at 74,278,633 bp
  • T to C, chromosome 1 at 144,002,148 bp
  • A to T, chromosome 2 at 80,506,892 bp
  • A to T, chromosome 2 at 173,105,977 bp
  • C to T, chromosome 3 at 33,024,691 bp
  • T to C, chromosome 3 at 93,202,833 bp
  • CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT to CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT, chromosome 3 at 95,888,136 bp
  • A to T, chromosome 3 at 107,554,646 bp
  • T to A, chromosome 3 at 132,086,192 bp
  • A to C, chromosome 4 at 49,381,803 bp
  • A to T, chromosome 4 at 56,796,535 bp
  • T to C, chromosome 4 at 81,335,751 bp
  • C to T, chromosome 4 at 130,533,925 bp
  • C to T, chromosome 4 at 156,171,839 bp
  • T to C, chromosome 5 at 3,851,459 bp
  • T to C, chromosome 5 at 31,254,262 bp
  • G to A, chromosome 5 at 89,046,236 bp
  • A to G, chromosome 5 at 108,680,895 bp
  • A to G, chromosome 5 at 121,308,342 bp
  • A to G, chromosome 5 at 122,680,820 bp
  • T to A, chromosome 6 at 41,847,631 bp
  • C to T, chromosome 6 at 42,405,751 bp
  • T to A, chromosome 6 at 43,275,208 bp
  • G to T, chromosome 6 at 90,022,353 bp
  • T to A, chromosome 6 at 93,815,750 bp
  • T to A, chromosome 6 at 115,807,807 bp
  • A to C, chromosome 6 at 131,630,248 bp
  • T to A, chromosome 6 at 136,329,537 bp
  • A to T, chromosome 6 at 137,479,074 bp
  • C to A, chromosome 7 at 4,921,064 bp
  • A to G, chromosome 7 at 4,936,601 bp
  • T to A, chromosome 7 at 7,563,897 bp
  • C to T, chromosome 7 at 15,757,924 bp
  • C to A, chromosome 7 at 30,635,649 bp
  • C to T, chromosome 7 at 41,044,209 bp
  • C to T, chromosome 7 at 44,923,804 bp
  • A to T, chromosome 7 at 80,329,821 bp
  • A to G, chromosome 7 at 108,825,979 bp
  • A to T, chromosome 7 at 144,580,785 bp
  • C to T, chromosome 8 at 45,999,854 bp
  • G to A, chromosome 8 at 70,076,006 bp
  • A to T, chromosome 8 at 76,908,963 bp
  • A to C, chromosome 8 at 93,215,144 bp
  • T to A, chromosome 8 at 93,302,948 bp
  • G to T, chromosome 8 at 112,011,420 bp
  • A to T, chromosome 9 at 27,322,668 bp
  • A to T, chromosome 9 at 65,857,345 bp
  • A to G, chromosome 9 at 122,797,705 bp
  • T to A, chromosome 10 at 80,311,156 bp
  • T to C, chromosome 10 at 127,556,965 bp
  • T to C, chromosome 10 at 130,210,942 bp
  • A to G, chromosome 11 at 34,419,873 bp
  • G to T, chromosome 11 at 73,277,992 bp
  • T to C, chromosome 13 at 11,686,978 bp
  • A to T, chromosome 13 at 56,523,527 bp
  • G to A, chromosome 13 at 59,466,038 bp
  • G to A, chromosome 14 at 14,765,580 bp
  • T to C, chromosome 14 at 20,381,785 bp
  • G to C, chromosome 14 at 55,104,451 bp
  • T to A, chromosome 15 at 9,175,196 bp
  • T to A, chromosome 15 at 12,376,123 bp
  • T to C, chromosome 15 at 77,807,910 bp
  • A to G, chromosome 16 at 78,967,998 bp
  • A to G, chromosome 16 at 87,418,494 bp
  • C to A, chromosome 16 at 96,825,564 bp
  • A to G, chromosome 17 at 15,374,869 bp
  • T to A, chromosome 17 at 24,223,915 bp
  • C to T, chromosome 17 at 43,599,076 bp
  • T to C, chromosome 17 at 44,102,037 bp
  • T to A, chromosome 17 at 56,097,532 bp
  • T to C, chromosome 17 at 71,394,823 bp
  • G to A, chromosome 18 at 5,767,867 bp
  • A to T, chromosome 18 at 42,578,956 bp
  • A to T, chromosome 18 at 44,276,156 bp
  • C to A, chromosome 19 at 5,603,961 bp
  • A to G, chromosome 19 at 29,282,411 bp
  • A to T, chromosome 19 at 34,593,902 bp
  • A to G, chromosome 19 at 38,779,785 bp
  • G to C, chromosome 19 at 40,376,800 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7180 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045233-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.