Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7184Btlr/Mmmh
Stock Number:
045236-MU
Citation ID:
RRID:MMRRC_045236-MU
Other Names:
R7184 (G1)
Major Collection:

Strain Information

Map4k5
Name: mitogen-activated protein kinase kinase kinase kinase 5
Synonyms: MAPKKKK5, GCKR, KHS, 4432415E19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 399510
HGNC: HGNC:6867
Homologene: 38199
Htr4
Name: 5 hydroxytryptamine (serotonin) receptor 4
Synonyms: 5-HT4L, 5-HT4
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 15562
VEGA: 18
HGNC: HGNC:5299
Homologene: 20243
Cdon
Name: cell adhesion associated, oncogene regulated
Synonyms: CAM-related/down-regulated by oncogenes, CDO
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 57810
Homologene: 22996
Slc26a5
Name: solute carrier family 26, member 5
Synonyms: Pres, prestin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80979
HGNC: HGNC:9359
Homologene: 69472
Nrxn2
Name: neurexin II
Synonyms: neurexin II beta, neurexin II alpha, 6430591O13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18190
HGNC: HGNC:8009
Homologene: 86984
Gtf2h3
Name: general transcription factor IIH, polypeptide 3
Synonyms: 5033417D07Rik, BTF2, D5Ertd679e, 34kDa
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 209357
HGNC: HGNC:4657
Homologene: 1160
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 59,265,655 bp
  • G to T, chromosome 1 at 63,306,505 bp
  • T to C, chromosome 1 at 78,482,357 bp
  • T to C, chromosome 1 at 93,154,515 bp
  • A to G, chromosome 1 at 93,603,415 bp
  • A to G, chromosome 1 at 139,733,084 bp
  • G to T, chromosome 1 at 156,259,935 bp
  • T to A, chromosome 1 at 167,357,396 bp
  • C to T, chromosome 1 at 181,704,529 bp
  • A to T, chromosome 1 at 181,922,392 bp
  • A to G, chromosome 2 at 6,023,320 bp
  • A to G, chromosome 2 at 129,123,922 bp
  • T to C, chromosome 2 at 148,442,539 bp
  • G to T, chromosome 2 at 150,408,136 bp
  • C to T, chromosome 3 at 31,227,063 bp
  • C to T, chromosome 3 at 85,636,951 bp
  • T to C, chromosome 3 at 89,091,887 bp
  • C to T, chromosome 3 at 116,251,994 bp
  • T to C, chromosome 3 at 133,473,630 bp
  • T to C, chromosome 3 at 135,523,154 bp
  • A to C, chromosome 4 at 43,968,667 bp
  • C to A, chromosome 4 at 53,694,054 bp
  • T to C, chromosome 4 at 106,491,912 bp
  • A to G, chromosome 4 at 124,714,979 bp
  • G to T, chromosome 5 at 21,837,246 bp
  • A to T, chromosome 5 at 109,053,415 bp
  • A to G, chromosome 5 at 124,584,004 bp
  • A to G, chromosome 5 at 145,705,853 bp
  • A to G, chromosome 6 at 23,094,220 bp
  • A to G, chromosome 6 at 23,247,836 bp
  • A to T, chromosome 6 at 23,583,429 bp
  • A to T, chromosome 6 at 24,092,312 bp
  • T to G, chromosome 6 at 88,891,794 bp
  • G to C, chromosome 6 at 146,311,087 bp
  • A to T, chromosome 7 at 11,880,988 bp
  • A to T, chromosome 7 at 21,133,895 bp
  • G to T, chromosome 7 at 31,051,976 bp
  • A to T, chromosome 7 at 101,580,451 bp
  • ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,713 bp
  • G to T, chromosome 8 at 69,102,567 bp
  • T to C, chromosome 8 at 107,392,647 bp
  • G to A, chromosome 8 at 110,887,156 bp
  • T to A, chromosome 8 at 123,509,121 bp
  • T to C, chromosome 9 at 21,233,838 bp
  • A to G, chromosome 9 at 35,463,895 bp
  • T to A, chromosome 10 at 99,108,604 bp
  • G to T, chromosome 10 at 99,134,337 bp
  • C to T, chromosome 10 at 107,763,200 bp
  • T to A, chromosome 11 at 71,788,717 bp
  • T to A, chromosome 12 at 69,874,321 bp
  • G to A, chromosome 12 at 87,919,722 bp
  • T to A, chromosome 12 at 114,391,855 bp
  • A to G, chromosome 13 at 27,098,636 bp
  • C to A, chromosome 13 at 67,294,001 bp
  • A to G, chromosome 14 at 51,116,930 bp
  • T to C, chromosome 15 at 81,956,214 bp
  • A to G, chromosome 16 at 46,395,121 bp
  • T to C, chromosome 17 at 17,893,271 bp
  • A to G, chromosome 17 at 23,607,029 bp
  • T to C, chromosome 17 at 33,934,990 bp
  • A to G, chromosome 17 at 50,800,082 bp
  • T to A, chromosome 18 at 62,437,427 bp
  • A to C, chromosome 18 at 65,447,693 bp
  • A to G, chromosome 19 at 6,490,552 bp
  • A to G, chromosome 19 at 27,426,012 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7184 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045236-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.