Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7184Btlr/Mmmh
Stock Number:
045236-MU
Citation ID:
RRID:MMRRC_045236-MU
Other Names:
R7184 (G1)
Major Collection:

Strain Information

Map4k5
Name: mitogen-activated protein kinase kinase kinase kinase 5
Synonyms: MAPKKKK5, GCKR, KHS, 4432415E19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 399510
HGNC: HGNC:6867
Homologene: 38199
Htr4
Name: 5 hydroxytryptamine (serotonin) receptor 4
Synonyms: 5-HT4L, 5-HT4
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 15562
VEGA: 18
HGNC: HGNC:5299
Homologene: 20243
Cdon
Name: cell adhesion molecule-related/down-regulated by oncogenes
Synonyms: CAM-related/down-regulated by oncogenes, CDO
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 57810
Homologene: 22996
Slc26a5
Name: solute carrier family 26, member 5
Synonyms: Pres, prestin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80979
HGNC: HGNC:9359
Homologene: 69472
Nrxn2
Name: neurexin II
Synonyms: neurexin II beta, neurexin II alpha, 6430591O13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18190
HGNC: HGNC:8009
Homologene: 86984
Gtf2h3
Name: general transcription factor IIH, polypeptide 3
Synonyms: 5033417D07Rik, BTF2, D5Ertd679e, 34kDa
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 209357
HGNC: HGNC:4657
Homologene: 1160
Manba
Name: mannosidase, beta A, lysosomal
Synonyms: Bmn, 2410030O07Rik, B930014J03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 110173
HGNC: HGNC:6831
Homologene: 4317
Zdbf2
Name: zinc finger, DBF-type containing 2
Synonyms: 9330107J05Rik, 4930431J08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73884
Homologene: 52868
Gpr88
Name: G-protein coupled receptor 88
Synonyms: Strg
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 64378
HGNC: HGNC:4539
Homologene: 11104
Tet2
Name: tet methylcytosine dioxygenase 2
Synonyms: E130014J05Rik, Ayu17-449
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 214133
Homologene: 49498
Tbc1d5
Name: TBC1 domain family, member 5
Synonyms: 1600014N05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72238
VEGA: 17
Homologene: 8834
Sf3a3
Name: splicing factor 3a, subunit 3
Synonyms: 4930512K19Rik, 60kDa
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75062
Homologene: 4949
Zfp442
Name: zinc finger protein 442
Synonyms: OTTMUSG00000015730
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 668923
Homologene: 136215
Mcm2
Name: minichromosome maintenance complex component 2
Synonyms: CDCL1, BM28, Mcmd2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17216
HGNC: HGNC:6944
Homologene: 3325
Malt1
Name: MALT1 paracaspase
Synonyms: D430033E09Rik, paracaspase, Pcasp1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240354
HGNC: HGNC:6819
Homologene: 4938
Polr1b
Name: polymerase (RNA) I polypeptide B
Synonyms: RPA2, RPA116, 128kDa, D630020H17Rik, Rpo1-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20017
Homologene: 7133
Nectin3
Name: nectin cell adhesion molecule 3
Synonyms: nectin-3, 4921513D19Rik, 2610301B19Rik, 3000002N23Rik, Pvrl3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 58998
Homologene: 9162
Atp6v1b2
Name: ATPase, H+ transporting, lysosomal V1 subunit B2
Synonyms: HO57, Atp6b2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11966
HGNC: HGNC:854
Homologene: 1279
Galnt4
Name: polypeptide N-acetylgalactosaminyltransferase 4
Synonyms: ppGaNTase-T4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14426
Homologene: 74511
Upf2
Name: UPF2 regulator of nonsense transcripts homolog (yeast)
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 326622
Homologene: 6101
Fezf1
Name: Fez family zinc finger 1
Synonyms: Zfp312-like, Fez, 3110069A13Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73191
Homologene: 19252
Zfp457
Name: zinc finger protein 457
Synonyms: Rslcan-6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 431706
Homologene: 75311
Pum3
Name: pumilio RNA-binding family member 3
Synonyms: 1110069H02Rik, D19Bwg1357e
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 52874
VEGA: 19
Homologene: 5762
Farsb
Name: phenylalanyl-tRNA synthetase, beta subunit
Synonyms: PheRS alpha, Frsb, Farsl, Farslb
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23874
Homologene: 4160
Pmm1
Name: phosphomannomutase 1
Synonyms: Secp53 (yeast) homolog
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 29858
HGNC: HGNC:9114
Homologene: 90898
Glipr2
Name: GLI pathogenesis-related 2
Synonyms: GAPR-1, 5730414A08Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 384009
Homologene: 74720
Wscd1
Name: WSC domain containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216881
Homologene: 18590
Itpr2
Name: inositol 1,4,5-triphosphate receptor 2
Synonyms: Ip3r2, Itpr5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16439
HGNC: HGNC:6181
Homologene: 37593
Zscan10
Name: zinc finger and SCAN domain containing 10
Synonyms: Zscan10, Zfp206
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 332221
Homologene: 13122
Fcsk
Name: fucose kinase
Synonyms: L-fucose kinase, 1110046B12Rik, Fuk
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234730
Homologene: 15452
Dnah14
Name: dynein, axonemal, heavy chain 14
Synonyms: LOC381311, A230079K17Rik, Gm980, Dnahc14
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240960
HGNC: HGNC:2945
Homologene: 90078
Fsd1l
Name: fibronectin type III and SPRY domain containing 1-like
Synonyms: A230072O16Rik, Csdufd1, Ccdc10, Fsd1nl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 319636
Homologene: 45825
Mab21l4
Name: mab-21-like 4
Synonyms: 2310007B03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71874
Homologene: 11761
Aldh9a1
Name: aldehyde dehydrogenase 9, subfamily A1
Synonyms: TMABA-DH, ESTM40
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56752
HGNC: HGNC:412
Homologene: 55483
Farp2
Name: FERM, RhoGEF and pleckstrin domain protein 2
Synonyms: Fir, D030026M03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227377
Homologene: 8877
Tdrd5
Name: tudor domain containing 5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 214575
Homologene: 18312
Slc7a14
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 14
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 241919
Homologene: 76320
Cd93
Name: CD93 antigen
Synonyms: AA4.1, C1qrp, Ly68, 6030404G09Rik, C1qr1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17064
Homologene: 7823
Otogl
Name: otogelin-like
Synonyms: Gm6924
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 628870
Homologene: 46008
Cfhr4
Name: complement factor H-related 4
Synonyms: Gm4788
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 214403
HGNC: HGNC:4883
Aass
Name: aminoadipate-semialdehyde synthase
Synonyms: LOR/SDH, Lorsdh
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 30956
Homologene: 4212
Cadps2
Name: Ca2+-dependent activator protein for secretion 2
Synonyms: cpd2, A230044C21Rik, Caps2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320405
Homologene: 23060
Vmn2r11
Name: vomeronasal 2, receptor 11
Synonyms: EG384219
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384219
Homologene: 129606
Cdk15
Name: cyclin dependent kinase 15
Synonyms: Als2cr7, Pftk2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 271697
Homologene: 64641
Slc13a1
Name: solute carrier family 13 (sodium/sulfate symporters), member 1
Synonyms: NaSi-1, Nas1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 55961
Homologene: 31893
Dbndd1
Name: dysbindin domain containing 1
Synonyms: D8Ertd590e, 2810427I04Rik, dysbindin (dystrobrevin binding protein 1) domain containing 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72185
Homologene: 11433
Rgl2
Name: ral guanine nucleotide dissociation stimulator-like 2
Synonyms: Rlf, KE1.5, Rab2l, Rgt2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19732
HGNC: HGNC:9769
Homologene: 3494
Rusc1
Name: RUN and SH3 domain containing 1
Synonyms: 2210403N08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72296
Homologene: 75028
Cyp3a41a
Name: cytochrome P450, family 3, subfamily a, polypeptide 41A
Synonyms: steroid inducible, Cyp3a41
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 53973
HGNC: HGNC:2638
Homologene: 133568
Vmn1r75
Name: vomeronasal 1 receptor 75
Synonyms: V1rg6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171241
Homologene: 44234
Poc1b
Name: POC1 centriolar protein B
Synonyms: 4933430F16Rik, Wdr51b
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 382406
Homologene: 41728
Prl3d1
Name: prolactin family 3, subfamily d, member 1
Synonyms: Pl-1, Pl1, prolactin-like 2, PL-Ia, Csh1, mPL-I, placental lactogen 1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18775
Homologene: 137215
Keap1
Name: kelch-like ECH-associated protein 1
Synonyms: ring canal protein, INrf2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 50868
Homologene: 8184
Bsnd
Name: barttin CLCNK type accessory beta subunit
Synonyms: Bartter syndrome, infantile, with sensorineural deafness (Barttin)
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 140475
Homologene: 14291
Art2b
Name: ADP-ribosyltransferase 2b
Synonyms: Rt6-2, Rt-6, Rt6, ART2.2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11872
Homologene: 113756
Fpr2
Name: formyl peptide receptor 2
Synonyms: E330010I07Rik, Fpr-rs2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14289
HGNC: HGNC:3827
Homologene: 74395
Fxyd1
Name: FXYD domain-containing ion transport regulator 1
Synonyms: phospholemman, PML, 0610012C17Rik, PLM, 1110006M24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56188
HGNC: HGNC:4025
Homologene: 3691
Vmn1r122
Name: vomeronasal 1 receptor 122
Synonyms: Gm5729
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 435951
Homologene: 104166
Eddm3b
Name: epididymal protein 3B
Synonyms: Fam12
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219026
VEGA: 14
Homologene: 75184
Nqo1
Name: NAD(P)H dehydrogenase, quinone 1
Synonyms: NMO1, NQO1, QR1, NAD(P)H dehydrogenase (quinone), Ox-1, Ox1, Nmor1, Dia4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18104
HGNC: HGNC:2874
Homologene: 695
Eif1ad14
Name: eukaryotic translation initiation factor 1A domain containing 14
Synonyms: Gm2035
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100039076
VEGA: 12
HGNC: HGNC:3252
Ighv6-3
Name: immunoglobulin heavy variable 6-3
Synonyms: Gm16930
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 629845
Gatb
Name: glutamyl-tRNA amidotransferase subunit B
Synonyms: 9430026F02Rik, Pet112l, Pet112
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229487
HGNC: HGNC:8849
Homologene: 3357
Krtap5-24
Name: keratin associated protein 5-24
Synonyms: Gm40460
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 105244938
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 59,265,655 bp
  • G to T, chromosome 1 at 63,306,505 bp
  • T to C, chromosome 1 at 78,482,357 bp
  • T to C, chromosome 1 at 93,154,515 bp
  • A to G, chromosome 1 at 93,603,415 bp
  • A to G, chromosome 1 at 139,733,084 bp
  • G to T, chromosome 1 at 156,259,935 bp
  • T to A, chromosome 1 at 167,357,396 bp
  • C to T, chromosome 1 at 181,704,529 bp
  • A to T, chromosome 1 at 181,922,392 bp
  • A to G, chromosome 2 at 6,023,320 bp
  • A to G, chromosome 2 at 129,123,922 bp
  • T to C, chromosome 2 at 148,442,539 bp
  • G to T, chromosome 2 at 150,408,136 bp
  • C to T, chromosome 3 at 31,227,063 bp
  • C to T, chromosome 3 at 85,636,951 bp
  • T to C, chromosome 3 at 89,091,887 bp
  • C to T, chromosome 3 at 116,251,994 bp
  • T to C, chromosome 3 at 133,473,630 bp
  • T to C, chromosome 3 at 135,523,154 bp
  • A to C, chromosome 4 at 43,968,667 bp
  • C to A, chromosome 4 at 53,694,054 bp
  • T to C, chromosome 4 at 106,491,912 bp
  • A to G, chromosome 4 at 124,714,979 bp
  • G to T, chromosome 5 at 21,837,246 bp
  • A to T, chromosome 5 at 109,053,415 bp
  • A to G, chromosome 5 at 124,584,004 bp
  • A to G, chromosome 5 at 145,705,853 bp
  • A to G, chromosome 6 at 23,094,220 bp
  • A to G, chromosome 6 at 23,247,836 bp
  • A to T, chromosome 6 at 23,583,429 bp
  • A to T, chromosome 6 at 24,092,312 bp
  • T to G, chromosome 6 at 88,891,794 bp
  • G to C, chromosome 6 at 146,311,087 bp
  • A to T, chromosome 7 at 11,880,988 bp
  • A to T, chromosome 7 at 21,133,895 bp
  • G to T, chromosome 7 at 31,051,976 bp
  • A to T, chromosome 7 at 101,580,451 bp
  • ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,713 bp
  • G to T, chromosome 8 at 69,102,567 bp
  • T to C, chromosome 8 at 107,392,647 bp
  • G to A, chromosome 8 at 110,887,156 bp
  • T to A, chromosome 8 at 123,509,121 bp
  • T to C, chromosome 9 at 21,233,838 bp
  • A to G, chromosome 9 at 35,463,895 bp
  • T to A, chromosome 10 at 99,108,604 bp
  • G to T, chromosome 10 at 99,134,337 bp
  • C to T, chromosome 10 at 107,763,200 bp
  • T to A, chromosome 11 at 71,788,717 bp
  • T to A, chromosome 12 at 69,874,321 bp
  • G to A, chromosome 12 at 87,919,722 bp
  • T to A, chromosome 12 at 114,391,855 bp
  • A to G, chromosome 13 at 27,098,636 bp
  • C to A, chromosome 13 at 67,294,001 bp
  • A to G, chromosome 14 at 51,116,930 bp
  • T to C, chromosome 15 at 81,956,214 bp
  • A to G, chromosome 16 at 46,395,121 bp
  • T to C, chromosome 17 at 17,893,271 bp
  • A to G, chromosome 17 at 23,607,029 bp
  • T to C, chromosome 17 at 33,934,990 bp
  • A to G, chromosome 17 at 50,800,082 bp
  • T to A, chromosome 18 at 62,437,427 bp
  • A to C, chromosome 18 at 65,447,693 bp
  • A to G, chromosome 19 at 6,490,552 bp
  • A to G, chromosome 19 at 27,426,012 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7184 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045236-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.