Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7146Btlr/Mmmh
Stock Number:
045251-MU
Citation ID:
RRID:MMRRC_045251-MU
Other Names:
R7146 (G1)
Major Collection:

Strain Information

Ide
Name: insulin degrading enzyme
Synonyms: 1300012G03Rik, 4833415K22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 15925
HGNC: HGNC:5381
Homologene: 3645
Sema3c
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C
Synonyms: Semae, 1110036B02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20348
Homologene: 36201
Sstr2
Name: somatostatin receptor 2
Synonyms: SSTR-2, sst2, Smstr2, Smstr-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20606
Homologene: 37427
Scarb1
Name: scavenger receptor class B, member 1
Synonyms: D5Ertd460e, Srb1, Cd36l1, Cla-1, SRBI, SR-BI, Hlb398, Hdlq1, Chohd1, Chohd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20778
HGNC: HGNC:1664
Homologene: 21132
Scn3a
Name: sodium channel, voltage-gated, type III, alpha
Synonyms: LOC381367, Nav1.3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20269
Homologene: 56005
Ssu72
Name: Ssu72 RNA polymerase II CTD phosphatase homolog (yeast)
Synonyms: 2610101M12Rik, 1190002E22Rik, 1500011L16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68991
Homologene: 6754
Adk
Name: adenosine kinase
Synonyms: AK, 5033405D03Rik, 2310026J05Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 11534
VEGA: 14
HGNC: HGNC:257
Homologene: 4891
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 58,158,529 bp
  • G to C, chromosome 1 at 60,237,151 bp
  • G to A, chromosome 1 at 100,050,794 bp
  • T to C, chromosome 1 at 152,861,825 bp
  • T to G, chromosome 1 at 159,244,352 bp
  • G to T, chromosome 2 at 41,375,994 bp
  • C to T, chromosome 2 at 53,068,540 bp
  • T to A, chromosome 2 at 65,483,142 bp
  • T to C, chromosome 2 at 70,587,362 bp
  • A to AC, chromosome 2 at 98,667,033 bp
  • T to C, chromosome 2 at 104,258,353 bp
  • T to C, chromosome 2 at 125,614,405 bp
  • T to C, chromosome 2 at 130,537,651 bp
  • C to T, chromosome 2 at 132,934,865 bp
  • A to T, chromosome 3 at 20,008,886 bp
  • T to C, chromosome 3 at 49,755,822 bp
  • G to A, chromosome 3 at 92,572,231 bp
  • C to T, chromosome 3 at 146,007,115 bp
  • A to G, chromosome 4 at 32,562,670 bp
  • T to C, chromosome 4 at 82,922,295 bp
  • A to G, chromosome 4 at 96,545,782 bp
  • T to A, chromosome 4 at 115,864,592 bp
  • A to G, chromosome 4 at 138,581,612 bp
  • T to A, chromosome 4 at 155,385,406 bp
  • T to C, chromosome 4 at 155,731,393 bp
  • G to A, chromosome 5 at 17,694,703 bp
  • A to T, chromosome 5 at 22,106,097 bp
  • T to C, chromosome 5 at 27,498,710 bp
  • C to T, chromosome 5 at 109,003,334 bp
  • T to C, chromosome 5 at 114,775,232 bp
  • C to T, chromosome 5 at 125,284,025 bp
  • G to A, chromosome 5 at 130,024,449 bp
  • C to A, chromosome 5 at 137,071,064 bp
  • A to G, chromosome 6 at 5,491,068 bp
  • A to T, chromosome 6 at 48,501,095 bp
  • C to T, chromosome 6 at 124,836,924 bp
  • T to A, chromosome 7 at 5,481,496 bp
  • T to A, chromosome 7 at 30,056,167 bp
  • A to T, chromosome 7 at 41,448,471 bp
  • A to T, chromosome 7 at 120,255,297 bp
  • A to G, chromosome 7 at 120,527,751 bp
  • A to T, chromosome 7 at 125,672,821 bp
  • A to T, chromosome 7 at 130,481,778 bp
  • C to T, chromosome 7 at 141,863,967 bp
  • A to T, chromosome 7 at 143,640,819 bp
  • T to C, chromosome 7 at 144,655,656 bp
  • G to A, chromosome 8 at 44,950,925 bp
  • T to A, chromosome 8 at 71,630,553 bp
  • G to T, chromosome 8 at 107,052,373 bp
  • T to A, chromosome 8 at 110,030,731 bp
  • A to T, chromosome 8 at 112,810,636 bp
  • T to A, chromosome 8 at 123,369,250 bp
  • C to A, chromosome 9 at 7,385,014 bp
  • A to G, chromosome 9 at 7,697,586 bp
  • T to C, chromosome 9 at 22,065,899 bp
  • T to C, chromosome 9 at 60,870,413 bp
  • T to A, chromosome 9 at 71,883,103 bp
  • A to G, chromosome 9 at 101,963,958 bp
  • A to T, chromosome 9 at 104,004,837 bp
  • T to A, chromosome 9 at 108,484,084 bp
  • T to A, chromosome 9 at 109,091,780 bp
  • A to T, chromosome 10 at 17,827,798 bp
  • T to C, chromosome 10 at 75,928,446 bp
  • T to G, chromosome 10 at 102,388,496 bp
  • C to T, chromosome 10 at 121,416,147 bp
  • A to T, chromosome 10 at 121,606,773 bp
  • A to T, chromosome 11 at 74,085,261 bp
  • G to A, chromosome 11 at 95,830,906 bp
  • A to G, chromosome 11 at 104,967,752 bp
  • A to C, chromosome 11 at 105,022,938 bp
  • G to T, chromosome 11 at 106,772,746 bp
  • A to T, chromosome 11 at 113,625,353 bp
  • T to C, chromosome 11 at 118,082,110 bp
  • A to T, chromosome 12 at 3,457,066 bp
  • T to A, chromosome 12 at 105,604,883 bp
  • A to T, chromosome 12 at 113,272,355 bp
  • T to C, chromosome 12 at 115,119,776 bp
  • C to A, chromosome 13 at 6,602,781 bp
  • G to T, chromosome 13 at 38,023,049 bp
  • A to G, chromosome 13 at 67,593,376 bp
  • T to A, chromosome 13 at 69,626,553 bp
  • C to A, chromosome 14 at 21,326,614 bp
  • T to C, chromosome 14 at 29,721,697 bp
  • A to T, chromosome 14 at 56,026,988 bp
  • G to A, chromosome 14 at 70,533,392 bp
  • A to T, chromosome 14 at 118,615,181 bp
  • C to A, chromosome 15 at 59,352,501 bp
  • T to A, chromosome 15 at 76,302,660 bp
  • A to C, chromosome 16 at 56,730,242 bp
  • A to T, chromosome 16 at 96,829,917 bp
  • T to C, chromosome 17 at 22,559,051 bp
  • A to G, chromosome 17 at 30,644,617 bp
  • T to C, chromosome 17 at 30,769,644 bp
  • G to A, chromosome 17 at 33,925,487 bp
  • G to A, chromosome 17 at 56,017,646 bp
  • T to G, chromosome 17 at 56,512,305 bp
  • T to A, chromosome 18 at 37,321,356 bp
  • C to A, chromosome 18 at 37,662,111 bp
  • G to T, chromosome 18 at 44,275,721 bp
  • GGGCCTGCAGACAGTAGGTGCTCACTAGGGCCTGTAAATAGTAGGTGCTCACTGAGGCCTGTAGACAGTAGGTGCTCA to GGGCCTGTAGACAGTAGGTGCTCA, chromosome 18 at 80,089,482 bp
  • A to T, chromosome 19 at 37,295,944 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7146 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045251-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.