Strain Name:
C57BL/6J-MtgxR7146Btlr/Mmmh
Stock Number:
045251-MU
Citation ID:
RRID:MMRRC_045251-MU
Other Names:
R7146 (G1)
Major Collection:

Strain Information

Ide
Name: insulin degrading enzyme
Synonyms: 1300012G03Rik, 4833415K22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 15925
HGNC: HGNC:5381
Homologene: 3645
Sema3c
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C
Synonyms: Semae, 1110036B02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20348
Homologene: 36201
Sstr2
Name: somatostatin receptor 2
Synonyms: SSTR-2, sst2, Smstr2, Smstr-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20606
Homologene: 37427
Scarb1
Name: scavenger receptor class B, member 1
Synonyms: D5Ertd460e, Srb1, Cd36l1, Cla-1, SRBI, SR-BI, Hlb398, Hdlq1, Chohd1, Chohd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20778
HGNC: HGNC:1664
Homologene: 21132
Scn3a
Name: sodium channel, voltage-gated, type III, alpha
Synonyms: LOC381367, Nav1.3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20269
Homologene: 56005
Ssu72
Name: Ssu72 RNA polymerase II CTD phosphatase homolog (yeast)
Synonyms: 2610101M12Rik, 1190002E22Rik, 1500011L16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68991
Homologene: 6754
Adk
Name: adenosine kinase
Synonyms: AK, 5033405D03Rik, 2310026J05Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 11534
VEGA: 14
HGNC: HGNC:257
Homologene: 4891
Ano1
Name: anoctamin 1, calcium activated chloride channel
Synonyms: Tmem16a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101772
Homologene: 75079
Ptpra
Name: protein tyrosine phosphatase receptor type A
Synonyms: RPTRalpha, PTPalpha, PTP[a], Ptpa, RPTPalpha
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19262
HGNC: HGNC:9664
Homologene: 20621
Lgi3
Name: leucine-rich repeat LGI family, member 3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 213469
VEGA: 14
Homologene: 16406
Ankrd13a
Name: ankyrin repeat domain 13a
Synonyms: 1100001D10Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68420
Homologene: 23814
Smg7
Name: SMG7 nonsense mediated mRNA decay factor
Synonyms: 9430023P16Rik, Smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226517
Homologene: 32235
Cop1
Name: COP1, E3 ubiquitin ligase
Synonyms: Cop1, Rfwd2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26374
Homologene: 115565
Tcf12
Name: transcription factor 12
Synonyms: ME1, ALF1, HEB, HTF4, HTF-4, REB, bHLHb20, HEBAlt
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21406
Homologene: 40774
Asxl2
Name: ASXL transcriptional regulator 2
Synonyms: 4930556B16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 75302
Homologene: 10102
Uaca
Name: uveal autoantigen with coiled-coil domains and ankyrin repeats
Synonyms: nucling, 2700059D02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72565
VEGA: 9
Homologene: 74297
Gtf3c1
Name: general transcription factor III C 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233863
HGNC: HGNC:4664
Homologene: 31040
Abcc4
Name: ATP-binding cassette, sub-family C member 4
Synonyms: D630049P08Rik, MOAT-B, MRP4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239273
VEGA: 14
HGNC: HGNC:55
Homologene: 74563
Lamb2
Name: laminin, beta 2
Synonyms: Lamb-2, Lams, npht
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 16779
HGNC: HGNC:6487
Homologene: 1723
Sh3gl1
Name: SH3-domain GRB2-like 1
Synonyms: SH3P8, EEN, endophilin II, Sh3d2b, endophilin A2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20405
VEGA: 17
Homologene: 55709
Cog8
Name: component of oligomeric golgi complex 8
Synonyms: C87832
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 97484
Homologene: 13018
Ate1
Name: arginyltransferase 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11907
HGNC: HGNC:782
Homologene: 31420
Rassf3
Name: Ras association (RalGDS/AF-6) domain family member 3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 192678
VEGA: 10
Homologene: 16365
Bdkrb1
Name: bradykinin receptor, beta 1
Synonyms: kinin B1, B1R
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 12061
HGNC: HGNC:1029
Homologene: 570
Frem1
Name: Fras1 related extracellular matrix protein 1
Synonyms: eyem02Jus, heb, QBRICK, crf11, eyes2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329872
Homologene: 27049
Xpot
Name: exportin, tRNA (nuclear export receptor for tRNAs)
Synonyms: EXPORTIN-T, C79645, 1110004L07Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73192
VEGA: 10
Homologene: 38291
Cacna2d3
Name: calcium channel, voltage-dependent, alpha2/delta subunit 3
Synonyms: alpha 2 delta-3, alpha2delta3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12294
Homologene: 74929
Bach2
Name: BTB and CNC homology, basic leucine zipper transcription factor 2
Synonyms: E030004N02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12014
Homologene: 7240
Nsun2
Name: NOL1/NOP2/Sun domain family member 2
Synonyms: Misu
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 28114
Homologene: 9817
Gad1
Name: glutamate decarboxylase 1
Synonyms: GAD67, Gad-1, Z49976, EP10, GAD44, GAD25
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14415
HGNC: HGNC:4092
Homologene: 635
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Fat1
Name: FAT atypical cadherin 1
Synonyms: mFat1, 2310038E12Rik, Fath
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14107
HGNC: HGNC:3595
Homologene: 66302
Mknk1
Name: MAP kinase-interacting serine/threonine kinase 1
Synonyms: Mnk1, 2410048M24Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17346
HGNC: HGNC:7110
Homologene: 37838
Pfkp
Name: phosphofructokinase, platelet
Synonyms: PFK-C, 1200015H23Rik, 9330125N24Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56421
HGNC: HGNC:8878
Homologene: 20579
Fmnl2
Name: formin-like 2
Synonyms: 5430425K04Rik, man
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71409
Homologene: 70871
Cep152
Name: centrosomal protein 152
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99100
Homologene: 37159
Zfp653
Name: zinc finger protein 653
Synonyms: E430039K05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319601
VEGA: 9
Homologene: 16346
Nbeal1
Name: neurobeachin like 1
Synonyms: A530050O19Rik, ALS2CR17, A530083I02Rik, 2310076G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269198
Homologene: 16453
Abca16
Name: ATP-binding cassette, sub-family A member 16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233810
Homologene: 132942
Mgat4c
Name: MGAT4 family, member C
Synonyms: 9130411I17Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67569
Homologene: 8297
Washc5
Name: WASH complex subunit 5
Synonyms: strumpellin, E430025E21Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223593
VEGA: 15
Homologene: 8898
Nphp3
Name: nephronophthisis 3 (adolescent)
Synonyms: D330020E01Rik, pcy, nephrocystin 3, 3632410F03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74025
HGNC: HGNC:7907
Homologene: 32697
Chst4
Name: carbohydrate sulfotransferase 4
Synonyms: high endothelial cell GlcNAC-6-sulphotransferase, HEC-GlcNAc6ST, GST-3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 26887
HGNC: HGNC:1972
Homologene: 4216
Pdk4
Name: pyruvate dehydrogenase kinase, isoenzyme 4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 27273
HGNC: HGNC:8812
Homologene: 129720
Reln
Name: reelin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19699
HGNC: HGNC:9957
Homologene: 3699
Hps3
Name: HPS3, biogenesis of lysosomal organelles complex 2 subunit 1
Synonyms: Hermansky-Pudlak syndrome 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12807
Homologene: 13019
Tapbp
Name: TAP binding protein
Synonyms: tapasin, TPN, D17Wsu91e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21356
Homologene: 2401
Dnah17
Name: dynein, axonemal, heavy chain 17
Synonyms: LOC382552, 2810003K23Rik, Dnahcl1, Dnahc17
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69926
HGNC: HGNC:2946
Homologene: 72102
Vmn2r57
Name: vomeronasal 2, receptor 57
Synonyms: EG269902
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269902
Homologene: 104832
Gm11639
Name: predicted gene 11639
Synonyms: Gm11639, Efcab15
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 105242472
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Dscam
Name: DS cell adhesion molecule
Synonyms: 4932410A21Rik, Down syndrome cell adhesion molecule
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13508
HGNC: HGNC:3039
Homologene: 74393
Gm10800
Name: predicted gene 10800
Type: Gene
Species: Mouse
Chromosome: 2
Cntnap4
Name: contactin associated protein-like 4
Synonyms: Caspr4, E130114F09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 170571
Homologene: 24912
Gnb3
Name: guanine nucleotide binding protein (G protein), beta 3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14695
HGNC: HGNC:4400
Homologene: 55628
D430041D05Rik
Name: RIKEN cDNA D430041D05 gene
Synonyms: G2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241589
Homologene: 115928
Oplah
Name: 5-oxoprolinase (ATP-hydrolysing)
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75475
HGNC: HGNC:8149
Homologene: 90938
Pcdhb5
Name: protocadherin beta 5
Synonyms: Pcdhb4A, PcdhbE
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93876
HGNC: HGNC:8689
Homologene: 75103
Vmn2r10
Name: vomeronasal 2, receptor 10
Synonyms: VR16, V2r16
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22307
Homologene: 129606
Muc5b
Name: mucin 5, subtype B, tracheobronchial
Synonyms: MUC9, MUC5, 2300002I04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74180
HGNC: HGNC:7516
Homologene: 136756
Vmn2r111
Name: vomeronasal 2, receptor 111
Synonyms: EG210876
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210876
Homologene: 86604
Syde2
Name: synapse defective 1, Rho GTPase, homolog 2 (C. elegans)
Synonyms: C430017H16Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 214804
Homologene: 19035
Unc13a
Name: unc-13 homolog A
Synonyms: Munc13-1, 2410078G03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382018
Homologene: 11279
Aox3
Name: aldehyde oxidase 3
Synonyms: AOH1, 1200011D03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71724
Homologene: 90899
Pcdh18
Name: protocadherin 18
Synonyms: PCDH68L
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73173
Homologene: 10389
Sspo
Name: SCO-spondin
Synonyms: C79529, Scospondin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243369
Homologene: 45453
Txlnb
Name: taxilin beta
Synonyms: Mdp77, 2310001N14Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 378431
Homologene: 44534
Ephb1
Name: Eph receptor B1
Synonyms: Elk, Hek6, Net, Cek6, Elkh, C130099E04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270190
HGNC: HGNC:3392
Homologene: 20936
Ccdc51
Name: coiled-coil domain containing 51
Synonyms: 5730568A12Rik, Mitok
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66658
Homologene: 11646
Cyp2j6
Name: cytochrome P450, family 2, subfamily j, polypeptide 6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13110
HGNC: HGNC:2634
Homologene: 68091
Abca14
Name: ATP-binding cassette, sub-family A member 14
Synonyms: 1700110B15Rik, 4930539G24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67928
Homologene: 86128
Polg2
Name: polymerase (DNA directed), gamma 2, accessory subunit
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 50776
HGNC: HGNC:9180
Homologene: 5221
Vwa5b1
Name: von Willebrand factor A domain containing 5B1
Synonyms: 4931403E03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75718
Homologene: 19431
Mmp1b
Name: matrix metallopeptidase 1b (interstitial collagenase)
Synonyms: Mcol-B
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83996
HGNC: HGNC:7155
Homologene: 130791
Spire2
Name: spire type actin nucleation factor 2
Synonyms: Spir-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234857
Homologene: 72212
Cntnap5b
Name: contactin associated protein-like 5B
Synonyms: Caspr5-2, C230078M14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241175
Homologene: 104295
Mcpt9
Name: mast cell protease 9
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17232
VEGA: 14
Homologene: 115745
Zfp616
Name: zinc finger protein 616
Synonyms: Gm12330
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327963
Homologene: 88945
Ivl
Name: involucrin
Synonyms: 1110019C06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16447
HGNC: HGNC:6187
Homologene: 137207
Mmp11
Name: matrix metallopeptidase 11
Synonyms: stromelysin 3, ST3, Stmy3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17385
HGNC: HGNC:7157
Homologene: 38116
Vmn2r28
Name: vomeronasal 2, receptor 28
Synonyms: EG665255
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 665255
Homologene: 129605
Zfp82
Name: zinc finger protein 82
Synonyms: KRAB16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330502
Homologene: 51177
Cage1
Name: cancer antigen 1
Synonyms: CAGE1, 4933427I01Rik, Ctag3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 71213
Homologene: 18484
Serpine1
Name: serine (or cysteine) peptidase inhibitor, clade E, member 1
Synonyms: PAI-1, PAI1, Planh1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18787
HGNC: HGNC:8583
Homologene: 68070
Gabrd
Name: gamma-aminobutyric acid (GABA) A receptor, subunit delta
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14403
HGNC: HGNC:4084
Homologene: 55489
Npy6r
Name: neuropeptide Y receptor Y6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 18169
VEGA: 18
HGNC: HGNC:7959
Homologene: 134692
Ighe
Name: Immunoglobulin heavy constant epsilon
Synonyms: LOC380792, Gm900
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 380792
HGNC: HGNC:5522
Adgrg7
Name: adhesion G protein-coupled receptor G7
Synonyms: 9130020O16Rik, Gpr128
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239853
Homologene: 13115
Fermt1
Name: fermitin family member 1
Synonyms: Kindlin-1, 5830467P10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241639
Homologene: 9773
Tnfrsf22
Name: tumor necrosis factor receptor superfamily, member 22
Synonyms: Tnfrh2, 2810028K06Rik, SOBa, mDcTrailr2, C130035G06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 79202
Homologene: 84848
Speer4b
Name: spermatogenesis associated glutamate (E)-rich protein 4B
Synonyms: 1700081O22Rik, SPEER-4B
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 73526
Homologene: 69402
Mmp7
Name: matrix metallopeptidase 7
Synonyms: matrilysin, MAT
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17393
HGNC: HGNC:7174
Homologene: 37619
Znrf4
Name: zinc and ring finger 4
Synonyms: spzn
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20834
VEGA: 17
Homologene: 7959
Phospho1
Name: phosphatase, orphan 1
Synonyms: D11Moh36
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237928
Homologene: 13330
Asl
Name: argininosuccinate lyase
Synonyms: 2510006M18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 109900
HGNC: HGNC:746
Homologene: 32
Pcdhga1
Name: protocadherin gamma subfamily A, 1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93709
HGNC: HGNC:8696
Homologene: 56824
Zfp729b
Name: zinc finger protein 729b
Synonyms: AA987161
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 100416706
Homologene: 133713
Gm21886
Name: predicted gene, 21886
Type: Gene
Species: Mouse
Chromosome: 18
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 58,158,529 bp
  • G to C, chromosome 1 at 60,237,151 bp
  • G to A, chromosome 1 at 100,050,794 bp
  • T to C, chromosome 1 at 152,861,825 bp
  • T to G, chromosome 1 at 159,244,352 bp
  • G to T, chromosome 2 at 41,375,994 bp
  • C to T, chromosome 2 at 53,068,540 bp
  • T to A, chromosome 2 at 65,483,142 bp
  • T to C, chromosome 2 at 70,587,362 bp
  • A to AC, chromosome 2 at 98,667,033 bp
  • T to C, chromosome 2 at 104,258,353 bp
  • T to C, chromosome 2 at 125,614,405 bp
  • T to C, chromosome 2 at 130,537,651 bp
  • C to T, chromosome 2 at 132,934,865 bp
  • A to T, chromosome 3 at 20,008,886 bp
  • T to C, chromosome 3 at 49,755,822 bp
  • G to A, chromosome 3 at 92,572,231 bp
  • C to T, chromosome 3 at 146,007,115 bp
  • A to G, chromosome 4 at 32,562,670 bp
  • T to C, chromosome 4 at 82,922,295 bp
  • A to G, chromosome 4 at 96,545,782 bp
  • T to A, chromosome 4 at 115,864,592 bp
  • A to G, chromosome 4 at 138,581,612 bp
  • T to A, chromosome 4 at 155,385,406 bp
  • T to C, chromosome 4 at 155,731,393 bp
  • G to A, chromosome 5 at 17,694,703 bp
  • A to T, chromosome 5 at 22,106,097 bp
  • T to C, chromosome 5 at 27,498,710 bp
  • C to T, chromosome 5 at 109,003,334 bp
  • T to C, chromosome 5 at 114,775,232 bp
  • C to T, chromosome 5 at 125,284,025 bp
  • G to A, chromosome 5 at 130,024,449 bp
  • C to A, chromosome 5 at 137,071,064 bp
  • A to G, chromosome 6 at 5,491,068 bp
  • A to T, chromosome 6 at 48,501,095 bp
  • C to T, chromosome 6 at 124,836,924 bp
  • T to A, chromosome 7 at 5,481,496 bp
  • T to A, chromosome 7 at 30,056,167 bp
  • A to T, chromosome 7 at 41,448,471 bp
  • A to T, chromosome 7 at 120,255,297 bp
  • A to G, chromosome 7 at 120,527,751 bp
  • A to T, chromosome 7 at 125,672,821 bp
  • A to T, chromosome 7 at 130,481,778 bp
  • C to T, chromosome 7 at 141,863,967 bp
  • A to T, chromosome 7 at 143,640,819 bp
  • T to C, chromosome 7 at 144,655,656 bp
  • G to A, chromosome 8 at 44,950,925 bp
  • T to A, chromosome 8 at 71,630,553 bp
  • G to T, chromosome 8 at 107,052,373 bp
  • T to A, chromosome 8 at 110,030,731 bp
  • A to T, chromosome 8 at 112,810,636 bp
  • T to A, chromosome 8 at 123,369,250 bp
  • C to A, chromosome 9 at 7,385,014 bp
  • A to G, chromosome 9 at 7,697,586 bp
  • T to C, chromosome 9 at 22,065,899 bp
  • T to C, chromosome 9 at 60,870,413 bp
  • T to A, chromosome 9 at 71,883,103 bp
  • A to G, chromosome 9 at 101,963,958 bp
  • A to T, chromosome 9 at 104,004,837 bp
  • T to A, chromosome 9 at 108,484,084 bp
  • T to A, chromosome 9 at 109,091,780 bp
  • A to T, chromosome 10 at 17,827,798 bp
  • T to C, chromosome 10 at 75,928,446 bp
  • T to G, chromosome 10 at 102,388,496 bp
  • C to T, chromosome 10 at 121,416,147 bp
  • A to T, chromosome 10 at 121,606,773 bp
  • A to T, chromosome 11 at 74,085,261 bp
  • G to A, chromosome 11 at 95,830,906 bp
  • A to G, chromosome 11 at 104,967,752 bp
  • A to C, chromosome 11 at 105,022,938 bp
  • G to T, chromosome 11 at 106,772,746 bp
  • A to T, chromosome 11 at 113,625,353 bp
  • T to C, chromosome 11 at 118,082,110 bp
  • A to T, chromosome 12 at 3,457,066 bp
  • T to A, chromosome 12 at 105,604,883 bp
  • A to T, chromosome 12 at 113,272,355 bp
  • T to C, chromosome 12 at 115,119,776 bp
  • C to A, chromosome 13 at 6,602,781 bp
  • G to T, chromosome 13 at 38,023,049 bp
  • A to G, chromosome 13 at 67,593,376 bp
  • T to A, chromosome 13 at 69,626,553 bp
  • C to A, chromosome 14 at 21,326,614 bp
  • T to C, chromosome 14 at 29,721,697 bp
  • A to T, chromosome 14 at 56,026,988 bp
  • G to A, chromosome 14 at 70,533,392 bp
  • A to T, chromosome 14 at 118,615,181 bp
  • C to A, chromosome 15 at 59,352,501 bp
  • T to A, chromosome 15 at 76,302,660 bp
  • A to C, chromosome 16 at 56,730,242 bp
  • A to T, chromosome 16 at 96,829,917 bp
  • T to C, chromosome 17 at 22,559,051 bp
  • A to G, chromosome 17 at 30,644,617 bp
  • T to C, chromosome 17 at 30,769,644 bp
  • G to A, chromosome 17 at 33,925,487 bp
  • G to A, chromosome 17 at 56,017,646 bp
  • T to G, chromosome 17 at 56,512,305 bp
  • T to A, chromosome 18 at 37,321,356 bp
  • C to A, chromosome 18 at 37,662,111 bp
  • G to T, chromosome 18 at 44,275,721 bp
  • GGGCCTGCAGACAGTAGGTGCTCACTAGGGCCTGTAAATAGTAGGTGCTCACTGAGGCCTGTAGACAGTAGGTGCTCA to GGGCCTGTAGACAGTAGGTGCTCA, chromosome 18 at 80,089,482 bp
  • A to T, chromosome 19 at 37,295,944 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7146 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045251-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.