Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7157Btlr/Mmmh
Stock Number:
045258-MU
Citation ID:
RRID:MMRRC_045258-MU
Other Names:
R7157 (G1)
Major Collection:

Strain Information

Hlcs
Name: holocarboxylase synthetase (biotin- [propriony-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)
Synonyms: 410I21.SP6, D16Jhu34
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 110948
VEGA: 16
HGNC: HGNC:4976
Homologene: 37302
Gad2
Name: glutamic acid decarboxylase 2
Synonyms: GAD65, Gad-2, 6330404F12Rik, GAD(65)
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14417
HGNC: HGNC:4093
Homologene: 20223
Kdm4c
Name: lysine (K)-specific demethylase 4C
Synonyms: 2410141F18Rik, Jmjd2c
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76804
Homologene: 41004
Arhgef10
Name: Rho guanine nucleotide exchange factor 10
Synonyms: 6430549H08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234094
Homologene: 22827
Wfs1
Name: wolframin ER transmembrane glycoprotein
Synonyms: wolframin, Wolfram syndrome 1 homolog (human)
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22393
Homologene: 4380
Xpa
Name: xeroderma pigmentosum, complementation group A
Synonyms: Xpac
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22590
Homologene: 37298
Smc3
Name: structural maintenance of chromosomes 3
Synonyms: SmcD, Bamacan, Mmip1, Cspg6
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13006
HGNC: HGNC:2468
Homologene: 3974
2610021A01Rik
Name: RIKEN cDNA 2610021A01 gene
Type: Gene
Species: Mouse
Chromosome: 7
Atr
Name: ataxia telangiectasia and Rad3 related
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245000
HGNC: HGNC:882
Homologene: 96916
Ap3b1
Name: adaptor-related protein complex 3, beta 1 subunit
Synonyms: rim2, recombination induced mutation 2, Hps2, beta3A, AP-3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 11774
VEGA: 13
HGNC: HGNC:566
Homologene: 68125
Sf3a3
Name: splicing factor 3a, subunit 3
Synonyms: 4930512K19Rik, 60kDa
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75062
Homologene: 4949
Rps6ka5
Name: ribosomal protein S6 kinase, polypeptide 5
Synonyms: 6330404E13Rik, MSK1, 3110005L17Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 73086
VEGA: 12
Homologene: 48302
Fasn
Name: fatty acid synthase
Synonyms: FAS, A630082H08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14104
HGNC: HGNC:3594
Homologene: 55800
Elp1
Name: elongator complex protein 1
Synonyms: 3110040G09Rik, C78473, IKAP, Ikbkap
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230233
HGNC: HGNC:5959
Homologene: 2699
Cog8
Name: component of oligomeric golgi complex 8
Synonyms: C87832
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 97484
Homologene: 13018
Ift80
Name: intraflagellar transport 80
Synonyms: 4921524P20Rik, Wdr56
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68259
Homologene: 12253
Card6
Name: caspase recruitment domain family, member 6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239319
Homologene: 13067
Abca17
Name: ATP-binding cassette, sub-family A member 17
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381072
Homologene: 86807
6030468B19Rik
Name: RIKEN cDNA 6030468B19 gene
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77727
Homologene: 90660
Hamp
Name: hepcidin antimicrobial peptide
Synonyms: Hepc, HEPC1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 84506
Homologene: 10911
Ppie
Name: peptidylprolyl isomerase E (cyclophilin E)
Synonyms: 2010010D16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56031
HGNC: HGNC:9258
Homologene: 38142
Nbeal1
Name: neurobeachin like 1
Synonyms: A530050O19Rik, ALS2CR17, A530083I02Rik, 2310076G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269198
Homologene: 16453
Bicdl1
Name: BICD family like cargo adaptor 1
Synonyms: 2210403N09Rik, BICDR-1, Ccdc64
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75665
Homologene: 18013
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Trpm6
Name: transient receptor potential cation channel, subfamily M, member 6
Synonyms: CHAK2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225997
VEGA: 19
Homologene: 9767
Drc7
Name: dynein regulatory complex subunit 7
Synonyms: LOC330830, SRG-L, Ccdc135
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330830
Homologene: 12996
Tnn
Name: tenascin N
Synonyms: Tnw, tenascin-W
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329278
Homologene: 18634
Aox2
Name: aldehyde oxidase 2
Synonyms: Aox3l1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213043
Homologene: 84622
Or10ak14
Name: olfactory receptor family 10 subfamily AK member 14
Synonyms: GA_x6K02T2QD9B-18795136-18796077, MOR259-4P, MOR259-4P, MOR259-9, Olfr1524-ps1, Olfr1338
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 258259
Homologene: 115537
Serac1
Name: serine active site containing 1
Synonyms: 4930511N22Rik, D17Ertd141e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 321007
Homologene: 41900
Lipn
Name: lipase, family member N
Synonyms: 2210418G03Rik, Lipl4
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 70166
Homologene: 66969
Or4k5
Name: olfactory receptor family 4 subfamily K member 5
Synonyms: GA_x6K02T2PMLR-5839874-5838903, MOR246-6, Olfr729
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258275
Homologene: 17167
Cmah
Name: cytidine monophospho-N-acetylneuraminic acid hydroxylase
Synonyms: CMP-NeuAc hydroxylase
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12763
HGNC: HGNC:2098
Homologene: 7269
Alpk2
Name: alpha-kinase 2
Synonyms: Hak
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225638
Homologene: 50475
Lpin3
Name: lipin 3
Synonyms: 9130206L11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 64899
Homologene: 84844
Pkn1
Name: protein kinase N1
Synonyms: Pkn, PRK1, PAK1, Stk3, Prkcl1, F730027O18Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 320795
HGNC: HGNC:9405
Homologene: 48130
Ninl
Name: ninein-like
Synonyms: LOC381388, LOC381387, 4930519N13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78177
Homologene: 57024
Clnk
Name: cytokine-dependent hematopoietic cell linker
Synonyms: MIST
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27278
Homologene: 8450
Tnk2
Name: tyrosine kinase, non-receptor, 2
Synonyms: P21cdc42Hs kinase, Ack, activated p21cdc42Hs kinase, ACK1, Pyk1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 51789
Homologene: 4224
Or8k30
Name: olfactory receptor family 8 subfamily K member 30
Synonyms: GA_x6K02T2Q125-47993761-47994702, MOR189-2, Olfr1076
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258401
Homologene: 17233
Kbtbd12
Name: kelch repeat and BTB (POZ) domain containing 12
Synonyms: 4833415F11Rik, 4933428M03Rik, Klhdc6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74589
Homologene: 52613
Dmac2l
Name: distal membrane arm assembly component 2 like
Synonyms: facyor B, 1110015E18Rik, Atp5s
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68055
VEGA: 12
Homologene: 12232
Or51b6b
Name: olfactory receptor family 51 subfamily B member 6B
Synonyms: GA_x6K02T2PBJ9-6384836-6383883, MOR1-4, Olfr623
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259126
Homologene: 133591
Or6s1
Name: olfactory receptor family 6 subfamily S member 1
Synonyms: GA_x6K02T2PMLR-6808276-6807281, MOR103-18, Olfr750
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 404319
Homologene: 19719
Efhb
Name: EF hand domain family, member B
Synonyms: 4921525D22Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 211482
VEGA: 17
Homologene: 16982
Dmgdh
Name: dimethylglycine dehydrogenase precursor
Synonyms: 1200014D15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 74129
Homologene: 8372
Vmn1r219
Name: vomeronasal 1 receptor 219
Synonyms: V1rh13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171272
Homologene: 110880
Or10a3
Name: olfactory receptor family 10 subfamily A member 3
Synonyms: GA_x6K02T2PBJ9-11211854-11210853, MOR268-5, Olfr518
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258303
HGNC: HGNC:8162
Homologene: 133601
Hgh1
Name: HGH1 homolog
Synonyms: D15Ertd741e, Brp16, Fam203a
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 59053
VEGA: 15
Homologene: 48742
Plekha2
Name: pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2
Synonyms: TAPP2, 6430512N22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 83436
Homologene: 41822
Lect2
Name: leukocyte cell-derived chemotaxin 2
Synonyms: chondromodulin-II
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16841
VEGA: 13
HGNC: HGNC:6550
Homologene: 1730
Dhrs7c
Name: dehydrogenase/reductase 7C
Synonyms: 1110001P11Rik, dehydrogenase/reductase (SDR family) member 7C
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68460
Homologene: 19108
Mogs
Name: mannosyl-oligosaccharide glucosidase
Synonyms: 1810017N02Rik, Gcs1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 57377
Homologene: 4593
Slc14a1
Name: solute carrier family 14 (urea transporter), member 1
Synonyms: 2610507K20Rik, UT-B, 3021401A05Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 108052
Homologene: 9285
Dnajc30
Name: DnaJ heat shock protein family (Hsp40) member C30
Synonyms: 1300007M11Rik, Wbscr18
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66114
Homologene: 36428
Dhrs9
Name: dehydrogenase/reductase 9
Synonyms: C730025I08Rik, Rdh15, dehydrogenase/reductase (SDR family) member 9
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241452
Homologene: 26079
Scgb2b12
Name: secretoglobin, family 2B, member 12
Synonyms: Gm9138, Abpbg12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 668379
Homologene: 83171
Hes3
Name: hes family bHLH transcription factor 3
Synonyms: bHLHb43
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15207
Homologene: 7358
Gm45861
Name: predicted gene 45861
Type: Gene
Species: Mouse
Chromosome: 8
Gm9195
Name: predicted gene 9195
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 675947
Homologene: 139067
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 58,283,492 bp
  • T to A, chromosome 1 at 60,237,158 bp
  • T to A, chromosome 1 at 60,260,634 bp
  • T to A, chromosome 1 at 160,126,377 bp
  • T to C, chromosome 2 at 22,635,023 bp
  • T to A, chromosome 2 at 69,393,158 bp
  • A to T, chromosome 2 at 76,784,380 bp
  • T to A, chromosome 2 at 86,509,025 bp
  • A to G, chromosome 2 at 150,949,343 bp
  • G to A, chromosome 2 at 160,898,707 bp
  • A to T, chromosome 3 at 68,990,944 bp
  • A to T, chromosome 4 at 46,185,612 bp
  • ACTTCTTCTTCTTCTTCTTCTTC to ACTTCTTCTTCTTCTTCTTC, chromosome 4 at 56,781,176 bp
  • T to A, chromosome 4 at 74,345,567 bp
  • A to G, chromosome 4 at 118,754,418 bp
  • T to C, chromosome 4 at 123,135,107 bp
  • T to C, chromosome 4 at 124,722,900 bp
  • A to G, chromosome 4 at 152,288,124 bp
  • C to T, chromosome 5 at 36,967,172 bp
  • A to T, chromosome 5 at 38,769,891 bp
  • G to T, chromosome 5 at 115,651,857 bp
  • C to A, chromosome 5 at 135,064,715 bp
  • T to A, chromosome 6 at 83,118,507 bp
  • C to T, chromosome 6 at 88,618,668 bp
  • A to C, chromosome 7 at 30,942,536 bp
  • A to G, chromosome 7 at 32,326,677 bp
  • G to A, chromosome 7 at 41,626,976 bp
  • A to C, chromosome 7 at 103,660,581 bp
  • G to A, chromosome 7 at 104,768,489 bp
  • A to G, chromosome 7 at 108,881,268 bp
  • T to A, chromosome 8 at 14,930,030 bp
  • A to G, chromosome 8 at 25,063,941 bp
  • A to T, chromosome 8 at 27,542,508 bp
  • A to T, chromosome 8 at 27,542,509 bp
  • A to G, chromosome 8 at 83,671,734 bp
  • A to C, chromosome 8 at 95,074,150 bp
  • A to G, chromosome 8 at 107,052,499 bp
  • T to A, chromosome 9 at 95,869,900 bp
  • G to A, chromosome 10 at 119,945,156 bp
  • G to T, chromosome 11 at 67,809,896 bp
  • T to A, chromosome 11 at 117,802,954 bp
  • T to A, chromosome 11 at 120,810,465 bp
  • A to T, chromosome 12 at 69,741,788 bp
  • T to C, chromosome 12 at 100,581,420 bp
  • T to A, chromosome 13 at 23,163,355 bp
  • T to C, chromosome 13 at 24,436,629 bp
  • A to G, chromosome 13 at 56,542,990 bp
  • G to A, chromosome 13 at 93,715,535 bp
  • T to A, chromosome 13 at 94,532,034 bp
  • A to T, chromosome 13 at 114,824,607 bp
  • A to G, chromosome 14 at 50,148,232 bp
  • A to G, chromosome 14 at 51,071,159 bp
  • A to G, chromosome 14 at 72,480,781 bp
  • A to T, chromosome 15 at 5,100,109 bp
  • T to C, chromosome 15 at 76,370,450 bp
  • G to A, chromosome 16 at 32,681,168 bp
  • T to A, chromosome 16 at 94,268,164 bp
  • A to T, chromosome 17 at 6,074,201 bp
  • A to T, chromosome 17 at 24,335,590 bp
  • A to T, chromosome 17 at 25,965,254 bp
  • A to C, chromosome 17 at 53,400,900 bp
  • T to A, chromosome 18 at 65,266,277 bp
  • A to G, chromosome 18 at 78,102,411 bp
  • T to C, chromosome 19 at 18,838,098 bp
  • T to A, chromosome 19 at 34,076,990 bp
  • T to A, chromosome 19 at 53,641,898 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7157 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045258-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.