Strain Name:
C57BL/6J-MtgxR7159Btlr/Mmmh
Stock Number:
045259-MU
Citation ID:
RRID:MMRRC_045259-MU
Other Names:
R7159 (G1)
Major Collection:

Strain Information

Myo5a
Name: myosin VA
Synonyms: 9630007J19Rik, Myo5, MyoVA, Dbv, flail, MVa
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17918
HGNC: HGNC:7602
Homologene: 20100
Tnrc6b
Name: trinucleotide repeat containing 6b
Synonyms: A730065C02Rik, 2700090M07Rik, D230019K20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 213988
VEGA: 15
Homologene: 66194
Ncam2
Name: neural cell adhesion molecule 2
Synonyms: RNCAM, Ncam-2, Ocam, R4B12 antigen
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17968
HGNC: HGNC:7657
Homologene: 3336
Stub1
Name: STIP1 homology and U-Box containing protein 1
Synonyms: 2210017D18Rik, CHIP, 0610033N24Rik, 2310040B03Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 56424
VEGA: 17
Homologene: 4281
Phf12
Name: PHD finger protein 12
Synonyms: PF1, 2410142K10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268448
Homologene: 10841
Arfgef2
Name: ADP ribosylation factor guanine nucleotide exchange factor 2
Synonyms: BIG2, E230011G24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99371
Homologene: 111880
Rc3h2
Name: ring finger and CCCH-type zinc finger domains 2
Synonyms: 2900024N03Rik, D930043C02Rik, 9430019J22Rik, Mnab, Rnf164
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 319817
Homologene: 28276
Arid1a
Name: AT-rich interaction domain 1A
Synonyms: Smarcf1, BAF250a, Osa1, 1110030E03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 93760
Homologene: 21216
Trip13
Name: thyroid hormone receptor interactor 13
Synonyms: D13Ertd328e, 2410002G23Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69716
Homologene: 3125
Akap13
Name: A kinase anchor protein 13
Synonyms: PROTO-LB, Ht31, 1700026G02Rik, PROTO-LBC, 5730522G15Rik, AKAP-Lbc, 5830460E08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Ddx39b
Name: DEAD box helicase 39b
Synonyms: 0610030D10Rik, D17H6S81E-1, Bat1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B, Bat-1, Bat1a
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 53817
Homologene: 48376
Lrp6
Name: low density lipoprotein receptor-related protein 6
Synonyms: skam26Jus, skax26, Cd, ska26
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16974
HGNC: HGNC:6698
Homologene: 1747
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Nbn
Name: nibrin
Synonyms: Nbs1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 27354
HGNC: HGNC:7652
Homologene: 1858
Casp12
Name: caspase 12
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12364
Homologene: 7654
Phox2b
Name: paired-like homeobox 2b
Synonyms: NBPhox, Dilp1, Pmx2b, Phox2b, GENA 269, Px2b
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18935
HGNC: HGNC:9143
Homologene: 68371
Trpm4
Name: transient receptor potential cation channel, subfamily M, member 4
Synonyms: 1110030C19Rik, TRPM4B, LTRPC4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68667
Homologene: 23033
Ankrd34b
Name: ankyrin repeat domain 34B
Synonyms: 6430502M16Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218440
Homologene: 18450
Chst15
Name: carbohydrate sulfotransferase 15
Synonyms: GalNAcS-6ST, MAd5, MAd5, 4631426J05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77590
Homologene: 8908
Ube2v2
Name: ubiquitin-conjugating enzyme E2 variant 2
Synonyms: 5730524P06Rik, 4632410D19Rik, 1110021H13Rik, MMS2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70620
Homologene: 55739
Btbd1
Name: BTB domain containing 1
Synonyms: 1190005H08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 83962
HGNC: HGNC:1120
Homologene: 23529
Prmt9
Name: protein arginine methyltransferase 9
Synonyms: Prmt10
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102182
Homologene: 16298
Scfd2
Name: Sec1 family domain containing 2
Synonyms: E430013M20Rik, STXBP1L1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 212986
Homologene: 77411
Med12l
Name: mediator complex subunit 12-like
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329650
Homologene: 43143
Ttn
Name: titin
Synonyms: connectin, shru, D330041I19Rik, 2310057K23Rik, mdm, D830007G01Rik, 2310074I15Rik, 1100001C23Rik, 2310036G12Rik, L56
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Myh15
Name: myosin, heavy chain 15
Synonyms: EG667772
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 667772
VEGA: 16
Homologene: 18929
Gsap
Name: gamma-secretase activating protein
Synonyms: Pion, A530088I07Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 212167
Homologene: 45504
Polq
Name: polymerase (DNA directed), theta
Synonyms: A430110D14Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 77782
HGNC: HGNC:9186
Homologene: 32727
Fhad1
Name: forkhead-associated phosphopeptide binding domain 1
Synonyms: 2900090M10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329977
Homologene: 77947
Man2b1
Name: mannosidase 2, alpha B1
Synonyms: lysosomal alpha-mannosidase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17159
HGNC: HGNC:6826
Homologene: 37322
Xylt1
Name: xylosyltransferase 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233781
Homologene: 32534
Ctsq
Name: cathepsin Q
Synonyms: 1600010J02Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 104002
Homologene: 122226
Prpsap1
Name: phosphoribosyl pyrophosphate synthetase-associated protein 1
Synonyms: PAP39, 5730409F23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67763
HGNC: HGNC:9466
Homologene: 55687
Or10j7
Name: olfactory receptor family 10 subfamily J member 7
Synonyms: GA_x6K02T2R7CC-664297-665229, Olfr1406, MOR267-5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258758
Homologene: 133644
Sema4f
Name: sema domain, immunoglobulin domain (Ig), TM domain, and short cytoplasmic domain
Synonyms: Sema W
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20355
Homologene: 3147
Scara3
Name: scavenger receptor class A, member 3
Synonyms: C130058N24Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219151
VEGA: 14
Homologene: 9437
Arsa
Name: arylsulfatase A
Synonyms: ASA, As2, As-2, AS-A
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11883
HGNC: HGNC:713
Homologene: 20138
Pygl
Name: liver glycogen phosphorylase
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 110095
HGNC: HGNC:9725
Homologene: 84371
Or2t35
Name: olfactory receptor family 2 subfamily T member 35
Synonyms: MOR274-4_i, Olfr721, MOR274-3P, GA_x6K02T2PLTE-6793523-6794528
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 257982
Krt84
Name: keratin 84
Synonyms: Krt2-3, Krt2-16, HRb-1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16680
VEGA: 15
HGNC: HGNC:6461
Homologene: 22473
Ccm2l
Name: cerebral cavernous malformation 2-like
Synonyms: BC020535
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228788
Homologene: 130991
Vwa5b1
Name: von Willebrand factor A domain containing 5B1
Synonyms: 4931403E03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75718
Homologene: 19431
Mapkbp1
Name: mitogen-activated protein kinase binding protein 1
Synonyms: 2810483F24Rik, Jnkbp1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26390
Homologene: 69109
Tmem247
Name: transmembrane protein 247
Synonyms: 1700090G07Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78469
Homologene: 54379
Kcna5
Name: potassium voltage-gated channel, shaker-related subfamily, member 5
Synonyms: Kv1.5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16493
HGNC: HGNC:6224
Homologene: 1683
Pcdhb9
Name: protocadherin beta 9
Synonyms: PcdhbI, Pcdhb4C
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93880
HGNC: HGNC:8689
Homologene: 87124
Nrg3
Name: neuregulin 3
Synonyms: ska
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18183
HGNC: HGNC:7999
Homologene: 32051
Trim61
Name: tripartite motif-containing 61
Synonyms: E330039K03Rik, Rnf35, 2czf61
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 260296
Or8j3c
Name: olfactory receptor family 8 subfamily J member 3C
Synonyms: GA_x6K02T2Q125-47892992-47892045, MOR185-1, Olfr1062
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259082
Homologene: 83135
Myom3
Name: myomesin family, member 3
Synonyms: 8430427K15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242702
Homologene: 19432
Ptpru
Name: protein tyrosine phosphatase receptor type U
Synonyms: RPTPlambda, Ptprl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19273
HGNC: HGNC:9683
Homologene: 4168
Rigi
Name: RNA sensor RIG-I
Synonyms: DEAD (Asp-Glu-Ala-Asp) box polypeptide 58, Ddx58, RIG-I, 6430573D20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230073
Homologene: 32215
Fndc1
Name: fibronectin type III domain containing 1
Synonyms: 1110027O12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68655
Caln1
Name: calneuron 1
Synonyms: Cabp8, 9630012C17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 140904
Homologene: 10966
Spata33
Name: spermatogenesis associated 33
Synonyms: 4732415M23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 320869
Homologene: 51900
Tlcd3b
Name: TLC domain containing 3B
Synonyms: Fam57b, A330104J06Rik, 1500016O10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68952
Homologene: 69491
Or2y1g
Name: olfactory receptor family 2 subfamily Y member 1G
Synonyms: MOR256-67_i, Olfr1393, GA_x6K02T2QP88-6154577-6153642, MOR256-24
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258463
Homologene: 81347
Slco1a7
Name: solute carrier organic anion transporter family, member 1a7
Synonyms: Gm5724
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 435927
Pdilt
Name: protein disulfide isomerase-like, testis expressed
Synonyms: 1700007B13Rik, PDILT
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71830
Homologene: 18382
B3gnt9
Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 9
Synonyms: B3gnt9-ps
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 97440
Homologene: 13250
Krt9
Name: keratin 9
Synonyms: Krt1-9, K9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 107656
HGNC: HGNC:6447
Homologene: 138337
Hdhd5
Name: haloacid dehalogenase like hydrolase domain containing 5
Synonyms: A930002G03Rik, Cecr5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 214932
HGNC: HGNC:1843
Homologene: 32816
Stard10
Name: StAR related lipid transfer domain containing 10
Synonyms: PC-TP2, Pctpl, TISP-81, Sdccag28, PCTP2, NY-C0-28, CGI-52
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56018
Homologene: 4841
Bbc3
Name: BCL2 binding component 3
Synonyms: PUMA
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 170770
Homologene: 8679
Gpr62
Name: G protein-coupled receptor 62
Synonyms: 4933402E03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 436090
Homologene: 50962
Pcdhga4
Name: protocadherin gamma subfamily A, 4
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93712
HGNC: HGNC:8702
Homologene: 81866
Lrrc3c
Name: leucine rich repeat containing 3C
Synonyms: LOC192852, Gm12
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192852
Homologene: 19077
Rdh5
Name: retinol dehydrogenase 5
Synonyms: cRDH
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19682
HGNC: HGNC:9940
Homologene: 2179
Zfp658
Name: zinc finger protein 658
Synonyms: Gm7145
Type: Gene
Species: Mouse
Chromosome: 1
Homologene: 88945
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to G, chromosome 1 at 117,985,831 bp
  • A to T, chromosome 1 at 173,184,323 bp
  • T to C, chromosome 2 at 37,409,647 bp
  • A to G, chromosome 2 at 76,730,574 bp
  • C to A, chromosome 2 at 76,909,748 bp
  • T to A, chromosome 2 at 86,423,612 bp
  • A to G, chromosome 2 at 120,025,132 bp
  • A to T, chromosome 2 at 153,070,867 bp
  • T to A, chromosome 2 at 166,826,928 bp
  • A to G, chromosome 3 at 59,276,017 bp
  • G to T, chromosome 4 at 15,983,677 bp
  • A to G, chromosome 4 at 40,213,804 bp
  • A to G, chromosome 4 at 131,819,540 bp
  • T to C, chromosome 4 at 133,753,568 bp
  • A to T, chromosome 4 at 135,808,851 bp
  • C to T, chromosome 4 at 138,575,422 bp
  • T to C, chromosome 4 at 141,951,616 bp
  • T to A, chromosome 5 at 21,270,620 bp
  • T to A, chromosome 5 at 67,097,585 bp
  • T to C, chromosome 5 at 74,531,343 bp
  • C to T, chromosome 5 at 130,822,997 bp
  • C to A, chromosome 6 at 82,917,883 bp
  • T to A, chromosome 6 at 120,523,471 bp
  • T to A, chromosome 6 at 126,533,629 bp
  • C to A, chromosome 6 at 134,507,551 bp
  • T to A, chromosome 6 at 141,773,778 bp
  • C to A, chromosome 7 at 16,313,808 bp
  • T to C, chromosome 7 at 45,327,268 bp
  • T to A, chromosome 7 at 75,730,579 bp
  • T to C, chromosome 7 at 81,818,209 bp
  • A to T, chromosome 7 at 101,343,136 bp
  • T to A, chromosome 7 at 117,637,602 bp
  • A to G, chromosome 7 at 119,487,951 bp
  • T to C, chromosome 7 at 126,827,495 bp
  • A to C, chromosome 7 at 132,270,258 bp
  • T to C, chromosome 8 at 65,013,874 bp
  • T to C, chromosome 8 at 77,555,764 bp
  • C to T, chromosome 8 at 85,087,280 bp
  • C to A, chromosome 8 at 105,254,432 bp
  • T to C, chromosome 8 at 123,214,395 bp
  • C to T, chromosome 9 at 5,353,763 bp
  • A to T, chromosome 9 at 75,171,563 bp
  • C to A, chromosome 9 at 106,465,442 bp
  • A to G, chromosome 10 at 128,918,315 bp
  • A to T, chromosome 11 at 49,280,358 bp
  • A to G, chromosome 11 at 78,023,540 bp
  • G to A, chromosome 11 at 98,599,318 bp
  • TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC to TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC, chromosome 11 at 100,189,077 bp
  • T to C, chromosome 11 at 116,494,044 bp
  • A to T, chromosome 12 at 70,197,406 bp
  • T to G, chromosome 13 at 11,810,908 bp
  • A to G, chromosome 13 at 61,038,923 bp
  • T to C, chromosome 13 at 73,920,011 bp
  • T to C, chromosome 13 at 92,439,462 bp
  • T to C, chromosome 14 at 14,407,251 bp
  • A to C, chromosome 14 at 38,370,735 bp
  • A to G, chromosome 14 at 65,920,780 bp
  • A to G, chromosome 15 at 80,887,022 bp
  • A to T, chromosome 15 at 89,474,718 bp
  • C to A, chromosome 15 at 101,529,609 bp
  • G to A, chromosome 16 at 15,581,084 bp
  • A to T, chromosome 16 at 37,062,853 bp
  • A to T, chromosome 16 at 49,061,574 bp
  • G to T, chromosome 16 at 81,490,374 bp
  • T to A, chromosome 17 at 7,800,931 bp
  • T to C, chromosome 17 at 25,832,064 bp
  • T to C, chromosome 17 at 35,247,010 bp
  • C to T, chromosome 17 at 86,918,282 bp
  • A to G, chromosome 18 at 37,401,492 bp
  • A to G, chromosome 18 at 37,686,919 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7159 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045259-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.