MMRRC:045259-MU

C to G, chromosome 1 at 117,985,831 bp
A to T, chromosome 1 at 173,184,323 bp
T to C, chromosome 2 at 37,409,647 bp
A to G, chromosome 2 at 76,730,574 bp
C to A, chromosome 2 at 76,909,748 bp
T to A, chromosome 2 at 86,423,612 bp
A to G, chromosome 2 at 120,025,132 bp
A to T, chromosome 2 at 153,070,867 bp
T to A, chromosome 2 at 166,826,928 bp
A to G, chromosome 3 at 59,276,017 bp
G to T, chromosome 4 at 15,983,677 bp
A to G, chromosome 4 at 40,213,804 bp
A to G, chromosome 4 at 131,819,540 bp
T to C, chromosome 4 at 133,753,568 bp
A to T, chromosome 4 at 135,808,851 bp
C to T, chromosome 4 at 138,575,422 bp
T to C, chromosome 4 at 141,951,616 bp
T to A, chromosome 5 at 21,270,620 bp
T to A, chromosome 5 at 67,097,585 bp
T to C, chromosome 5 at 74,531,343 bp
C to T, chromosome 5 at 130,822,997 bp
C to A, chromosome 6 at 82,917,883 bp
T to A, chromosome 6 at 120,523,471 bp
T to A, chromosome 6 at 126,533,629 bp
C to A, chromosome 6 at 134,507,551 bp
T to A, chromosome 6 at 141,773,778 bp
C to A, chromosome 7 at 16,313,808 bp
T to C, chromosome 7 at 45,327,268 bp
T to A, chromosome 7 at 75,730,579 bp
T to C, chromosome 7 at 81,818,209 bp
A to T, chromosome 7 at 101,343,136 bp
T to A, chromosome 7 at 117,637,602 bp
A to G, chromosome 7 at 119,487,951 bp
T to C, chromosome 7 at 126,827,495 bp
A to C, chromosome 7 at 132,270,258 bp
T to C, chromosome 8 at 65,013,874 bp
T to C, chromosome 8 at 77,555,764 bp
C to T, chromosome 8 at 85,087,280 bp
C to A, chromosome 8 at 105,254,432 bp
T to C, chromosome 8 at 123,214,395 bp
C to T, chromosome 9 at 5,353,763 bp
A to T, chromosome 9 at 75,171,563 bp
C to A, chromosome 9 at 106,465,442 bp
A to G, chromosome 10 at 128,918,315 bp
A to T, chromosome 11 at 49,280,358 bp
A to G, chromosome 11 at 78,023,540 bp
G to A, chromosome 11 at 98,599,318 bp
TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC to TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC, chromosome 11 at 100,189,077 bp
T to C, chromosome 11 at 116,494,044 bp
A to T, chromosome 12 at 70,197,406 bp
T to G, chromosome 13 at 11,810,908 bp
A to G, chromosome 13 at 61,038,923 bp
T to C, chromosome 13 at 73,920,011 bp
T to C, chromosome 13 at 92,439,462 bp
T to C, chromosome 14 at 14,407,251 bp
A to C, chromosome 14 at 38,370,735 bp
A to G, chromosome 14 at 65,920,780 bp
A to G, chromosome 15 at 80,887,022 bp
A to T, chromosome 15 at 89,474,718 bp
C to A, chromosome 15 at 101,529,609 bp
G to A, chromosome 16 at 15,581,084 bp
A to T, chromosome 16 at 37,062,853 bp
A to T, chromosome 16 at 49,061,574 bp
G to T, chromosome 16 at 81,490,374 bp
T to A, chromosome 17 at 7,800,931 bp
T to C, chromosome 17 at 25,832,064 bp
T to C, chromosome 17 at 35,247,010 bp
C to T, chromosome 17 at 86,918,282 bp
A to G, chromosome 18 at 37,401,492 bp
A to G, chromosome 18 at 37,686,919 bp

Strain Description [Including phenotype, strain background, strain development and suggested control mice]

Phenotype

G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.

Strain GQC Summary

Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice

Littermates of all relevant genotypes.

Strain Origin

Donor

Bruce Beutler, M.D., University of Texas Southwestern Medical Center.

Primary Reference

MUTAGENETIX record for R7159 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Strain Development

C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information Expand All

Health Status Report

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.

Appearance

Coat Color

Black

Breeding

MMRRC Breeding System

Random intra-strain mating

Breeding Scheme(s)

When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.

Overall Breeding Performance

Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain

Reproductive Statistics

Average litter size

Undetermined

Recommended wean age

3 weeks

Order Information Expand All

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Conditions of Distribution [Including applicable technology transfer agreements]

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)

MMRRC Item #	Description	Distribution Fee / Unit (US $) Shipping & Handling not included	Units	Notes
045259-MU-RESUS	Litter recovered from cryo-archive	$5,475.00 / Non-Profit	Litter	Recovered litter⁴; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

¹ The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

² An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

³ An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

⁴ The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.

Strain Detail Sheet

Strain Information Expand All

Colony and Husbandry Information Expand All

Order Information Expand All