Strain Name:
C57BL/6J-MtgxR7186Btlr/Mmmh
Stock Number:
045271-MU
Citation ID:
RRID:MMRRC_045271-MU
Other Names:
R7186 (G1)
Major Collection:

Strain Information

Adamts20
Name: ADAM metallopeptidase with thrombospondin type 1 motif 20
Synonyms: ADAMTS-20, bt
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223838
Homologene: 11808
Pknox1
Name: Pbx/knotted 1 homeobox
Synonyms: PREP1, D17Wsu76e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18771
HGNC: HGNC:9022
Homologene: 3363
Zfp934
Name: zinc finger protein 934
Synonyms: 6720457D02Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 77117
VEGA: 13
Usp32
Name: ubiquitin specific peptidase 32
Synonyms: 6430526O11Rik, 2900074J03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237898
Homologene: 13066
Rrp12
Name: ribosomal RNA processing 12 homolog
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107094
VEGA: 19
Homologene: 22370
Arid1a
Name: AT-rich interaction domain 1A
Synonyms: Osa1, 1110030E03Rik, Smarcf1, BAF250a
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 93760
Homologene: 21216
Gpbp1
Name: GC-rich promoter binding protein 1
Synonyms: 1700034P14Rik, D230035M11Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 73274
Homologene: 11292
Sec16a
Name: SEC16 homolog A, endoplasmic reticulum export factor
Synonyms: C230052J16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227648
Homologene: 10533
Ppp2ca
Name: protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform
Synonyms: PP2A
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19052
HGNC: HGNC:9299
Homologene: 37660
Rfx5
Name: regulatory factor X, 5 (influences HLA class II expression)
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 53970
HGNC: HGNC:9986
Ncapd2
Name: non-SMC condensin I complex, subunit D2
Synonyms: CNAP1, CAP-D2, 2810406C15Rik, 2810465G24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68298
Homologene: 6497
Nuf2
Name: NUF2, NDC80 kinetochore complex component
Synonyms: 2410003C07Rik, Nuf2R, Cdca1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66977
Homologene: 40205
Wars1
Name: tryptophanyl-tRNA synthetase1
Synonyms: Wars
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 22375
Homologene: 3084
Card6
Name: caspase recruitment domain family, member 6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239319
Homologene: 13067
Numb
Name: NUMB endocytic adaptor protein
Synonyms: m-numb
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18222
HGNC: HGNC:8060
Homologene: 2775
Gm4924
Name: predicted gene 4924
Synonyms: mIF1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237412
Rreb1
Name: ras responsive element binding protein 1
Synonyms: 1110037N09Rik, B930013M22Rik, sao
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68750
Homologene: 2218
Sgk3
Name: serum/glucocorticoid regulated kinase 3
Synonyms: fy, cytokine-independent survival kinase, Cisk, 2510015P22Rik, A330005P07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 170755
Homologene: 56582
Gda
Name: guanine deaminase
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14544
HGNC: HGNC:4212
Homologene: 3171
Cdc23
Name: CDC23 cell division cycle 23
Synonyms: D18Ertd243e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 52563
HGNC: HGNC:1724
Homologene: 3426
Deaf1
Name: DEAF1, transcription factor
Synonyms: C230009B13Rik, NUDR, suppressin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54006
Homologene: 9647
Gpr107
Name: G protein-coupled receptor 107
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 277463
Homologene: 81077
Stk32b
Name: serine/threonine kinase 32B
Synonyms: 2510009F08Rik, YANK2, STKG6, Stk32
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 64293
Homologene: 48654
Hpse
Name: heparanase
Synonyms: Hpa
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15442
HGNC: HGNC:5164
Homologene: 68528
Gipc1
Name: GIPC PDZ domain containing family, member 1
Synonyms: synectin, TIP-2, Semcap1, neurophilin1-IP, Glut1CIP, TaxIP2, Rgs19ip1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67903
HGNC: HGNC:1226
Homologene: 21167
Snx13
Name: sorting nexin 13
Synonyms: RGS-PX1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217463
VEGA: 12
Homologene: 41011
Clk4
Name: CDC like kinase 4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12750
Homologene: 56895
Or4f62
Name: olfactory receptor family 4 subfamily F member 62
Synonyms: GA_x6K02T2Q125-73202172-73203134, MOR245-16, Olfr1318
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258022
Homologene: 134079
Ralgapa2
Name: Ral GTPase activating protein, alpha subunit 2 (catalytic)
Synonyms: A230067G21Rik, RGC2, AS250
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241694
Homologene: 28131
Rubcnl
Name: RUN and cysteine rich domain containing beclin 1 interacting protein like
Synonyms: LOC380917, 5031414D18Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 271221
VEGA: 14
Homologene: 57021
Usp50
Name: ubiquitin specific peptidase 50
Synonyms: 1700086G18Rik, 4930511O11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75083
Homologene: 75281
Scn9a
Name: sodium channel, voltage-gated, type IX, alpha
Synonyms: PN1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20274
Homologene: 2237
Adcy2
Name: adenylate cyclase 2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 210044
VEGA: 13
HGNC: HGNC:233
Homologene: 75133
Flg
Name: filaggrin
Synonyms: profilaggrin, fillagrin, ft
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14246
VEGA: 3
Gpatch1
Name: G patch domain containing 1
Synonyms: 1300003A17Rik, Gpatc1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67471
Homologene: 41217
Hivep1
Name: human immunodeficiency virus type I enhancer binding protein 1
Synonyms: Cryabp1, alphaA-CRYBP1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110521
VEGA: 13
HGNC: HGNC:4920
Homologene: 1596
Adam39
Name: a disintegrin and metallopeptidase domain 39
Synonyms: 1700056P18Rik, testase 9
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 546055
HGNC: HGNC:199
Homologene: 128364
Micall1
Name: microtubule associated monooxygenase, calponin and LIM domain containing -like 1
Synonyms: Mus EST 820961, D15N2e, D15Mit260
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 27008
VEGA: 15
Homologene: 24911
Cdh24
Name: cadherin-like 24
Synonyms: cadherin 14-like, EY-cadherin, 1700040A22Rik, ENSMUSG00000022188
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239096
VEGA: 14
Homologene: 56951
Heg1
Name: heart development protein with EGF-like domains 1
Synonyms: LOC268884, 5530401I02Rik, 9530025L16Rik, 4632417D23Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 77446
Homologene: 35276
Vmn2r74
Name: vomeronasal 2, receptor 74
Synonyms: EG546980
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 546980
Homologene: 115466
Zfp879
Name: zinc finger protein 879
Synonyms: 9630041N07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 214779
Homologene: 45452
Gbp3
Name: guanylate binding protein 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 55932
Homologene: 137329
Krt87
Name: keratin 87
Synonyms: Krt2-25, Krt83
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 406219
VEGA: 15
Homologene: 133804
Nrg2
Name: neuregulin 2
Synonyms: NTAK, Don1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 100042150
HGNC: HGNC:7998
Homologene: 75024
Pde6a
Name: phosphodiesterase 6A, cGMP-specific, rod, alpha
Synonyms: Pdea
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225600
HGNC: HGNC:8785
Homologene: 380
Luzp2
Name: leucine zipper protein 2
Synonyms: 9330154K17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233271
Homologene: 45618
Aldh1a3
Name: aldehyde dehydrogenase family 1, subfamily A3
Synonyms: ALDH6, V1, retinaldehyde dehydrogenase 3, RALDH3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56847
HGNC: HGNC:409
Homologene: 68080
Tent5b
Name: terminal nucleotidyltransferase 5B
Synonyms: 4732473B16Rik, Fam46b
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100342
Homologene: 24928
Ido2
Name: indoleamine 2,3-dioxygenase 2
Synonyms: C230043N17Rik, Ido2, Indol1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 209176
Homologene: 48830
Uba1y
Name: ubiquitin-activating enzyme, Chr Y
Synonyms: Ube-2, A1s9Y-1, Ube1y-1, Sby, Ube1y1
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 22202
Homologene: 129435
Or56a3b
Name: olfactory receptor family 56 subfamily A member 3B
Synonyms: GA_x6K02T2PBJ9-7750163-7751110, MOR40-14, Olfr681
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 404318
Homologene: 81538
Cyp2j8
Name: cytochrome P450, family 2, subfamily j, polypeptide 8
Synonyms: OTTMUSG00000007938, Cyp2j8-ps
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 665095
HGNC: HGNC:2634
Homologene: 133819
Tmem33
Name: transmembrane protein 33
Synonyms: 5430406L04Rik, 2410089A21Rik, 2700052H22Rik, 1600019D15Rik, 1110006G02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67878
Homologene: 10018
Lsp1
Name: lymphocyte specific 1
Synonyms: WP34, leukocyte specific protein 1, pp52, p50, leukocyte-specific protein 1, lymphocyte-specific protein 1, Lsp-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16985
HGNC: HGNC:6707
Homologene: 1750
Or4d2b
Name: olfactory receptor family 4 subfamily D member 2B
Synonyms: GA_x6K02T2PAEV-9536824-9535889, MOR240-3, Olfr462
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258406
HGNC: HGNC:8294
Homologene: 64870
Art5
Name: ADP-ribosyltransferase 5
Synonyms: Yac-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11875
Homologene: 7231
Sirt7
Name: sirtuin 7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 209011
Homologene: 56152
Ptgdr
Name: prostaglandin D receptor
Synonyms: DP
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19214
HGNC: HGNC:9591
Homologene: 736
Bfar
Name: bifunctional apoptosis regulator
Synonyms: RNF47
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67118
Homologene: 9563
Vmn1r238
Name: vomeronasal 1 receptor, 238
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 100312476
Homologene: 128342
Rnase10
Name: ribonuclease, RNase A family, 10 (non-active)
Synonyms: 4930474F22Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 75019
VEGA: 14
Homologene: 19166
Elovl7
Name: ELOVL fatty acid elongase 7
Synonyms: 9130013K24Rik, ELOVL family member 7, elongation of long chain fatty acids (yeast)
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 74559
VEGA: 13
Homologene: 23672
Lurap1l
Name: leucine rich adaptor protein 1-like
Synonyms: 1110029A09Rik, WI-13707, D4Bwg0951e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 52829
Homologene: 12281
Clrn2
Name: clarin 2
Synonyms: EG624224, mpc169H
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 624224
Homologene: 84057
Saxo5
Name: stabilizer of axonemal microtubules 5
Synonyms: 1700019B03Rik, Tex45
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76406
Homologene: 52367
9930111J21Rik2
Name: RIKEN cDNA 9930111J21 gene 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245240
Sult2a7
Name: sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 7
Synonyms: Gm7231
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 638251
Tcstv7b
Name: Tcstv family member 7B
Synonyms: Gm21731
Type: Gene
Species: Mouse
Chromosome: 13
Ighv14-1
Name: immunoglobulin heavy variable 14-1
Synonyms: Gm16996
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 780801
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 9,886,002 bp
  • T to C, chromosome 1 at 169,525,385 bp
  • A to T, chromosome 2 at 26,440,703 bp
  • A to T, chromosome 2 at 31,152,359 bp
  • T to C, chromosome 2 at 66,534,223 bp
  • T to A, chromosome 2 at 112,156,162 bp
  • C to T, chromosome 2 at 126,783,298 bp
  • C to A, chromosome 2 at 146,388,486 bp
  • A to T, chromosome 3 at 93,279,945 bp
  • G to T, chromosome 3 at 94,958,348 bp
  • G to A, chromosome 3 at 142,564,162 bp
  • C to A, chromosome 4 at 80,911,510 bp
  • T to C, chromosome 4 at 96,475,550 bp
  • T to A, chromosome 4 at 133,486,207 bp
  • TGCCGCCGCCGCCGCCGCCGCCG to TGCCGCCGCCGCCGCCGCCG, chromosome 4 at 133,753,233 bp
  • G to T, chromosome 5 at 37,466,781 bp
  • T to C, chromosome 5 at 45,453,773 bp
  • G to C, chromosome 5 at 67,263,787 bp
  • T to A, chromosome 5 at 100,695,529 bp
  • A to G, chromosome 6 at 125,186,156 bp
  • C to T, chromosome 7 at 14,470,053 bp
  • A to T, chromosome 7 at 35,295,313 bp
  • A to G, chromosome 7 at 54,835,829 bp
  • A to G, chromosome 7 at 66,406,083 bp
  • A to T, chromosome 7 at 85,951,942 bp
  • G to T, chromosome 7 at 102,097,329 bp
  • A to G, chromosome 7 at 105,122,266 bp
  • T to C, chromosome 7 at 141,327,470 bp
  • T to C, chromosome 7 at 142,490,352 bp
  • T to C, chromosome 8 at 3,479,049 bp
  • A to T, chromosome 8 at 24,550,810 bp
  • A to T, chromosome 8 at 40,826,312 bp
  • A to G, chromosome 8 at 83,664,133 bp
  • T to C, chromosome 10 at 82,378,944 bp
  • T to A, chromosome 11 at 49,019,273 bp
  • A to G, chromosome 11 at 50,833,794 bp
  • T to C, chromosome 11 at 51,268,780 bp
  • T to A, chromosome 11 at 52,119,253 bp
  • A to T, chromosome 11 at 85,051,234 bp
  • G to A, chromosome 11 at 87,889,765 bp
  • C to T, chromosome 11 at 120,620,485 bp
  • G to C, chromosome 12 at 35,092,913 bp
  • A to G, chromosome 12 at 83,796,146 bp
  • A to G, chromosome 12 at 108,881,056 bp
  • T to C, chromosome 12 at 113,932,029 bp
  • A to G, chromosome 13 at 37,941,632 bp
  • A to G, chromosome 13 at 42,156,338 bp
  • A to T, chromosome 13 at 62,492,390 bp
  • A to G, chromosome 13 at 68,668,639 bp
  • A to G, chromosome 13 at 108,271,848 bp
  • A to G, chromosome 13 at 111,440,699 bp
  • C to T, chromosome 13 at 120,241,051 bp
  • A to T, chromosome 14 at 44,858,944 bp
  • A to T, chromosome 14 at 51,009,785 bp
  • G to C, chromosome 14 at 54,633,492 bp
  • A to C, chromosome 14 at 75,032,013 bp
  • TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG to TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG, chromosome 15 at 5,098,691 bp
  • A to G, chromosome 15 at 79,125,375 bp
  • A to G, chromosome 15 at 94,322,808 bp
  • A to T, chromosome 15 at 101,487,202 bp
  • T to C, chromosome 16 at 13,692,507 bp
  • T to C, chromosome 16 at 33,731,664 bp
  • C to T, chromosome 17 at 31,603,198 bp
  • A to C, chromosome 18 at 3,122,661 bp
  • G to A, chromosome 18 at 34,637,122 bp
  • A to G, chromosome 18 at 36,045,920 bp
  • T to A, chromosome 18 at 61,220,606 bp
  • A to T, chromosome 19 at 21,395,205 bp
  • C to A, chromosome 19 at 41,871,305 bp
  • A to G, chromosome Y at 825,537 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7186 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045271-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.