Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7186Btlr/Mmmh
Stock Number:
045271-MU
Citation ID:
RRID:MMRRC_045271-MU
Other Names:
R7186 (G1)
Major Collection:

Strain Information

Adamts20
Name: ADAM metallopeptidase with thrombospondin type 1 motif 20
Synonyms: ADAMTS-20, bt
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223838
Homologene: 11808
Pknox1
Name: Pbx/knotted 1 homeobox
Synonyms: PREP1, D17Wsu76e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18771
HGNC: HGNC:9022
Homologene: 3363
Usp32
Name: ubiquitin specific peptidase 32
Synonyms: 6430526O11Rik, 2900074J03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237898
Homologene: 13066
Rrp12
Name: ribosomal RNA processing 12 homolog
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107094
VEGA: 19
Homologene: 22370
Arid1a
Name: AT-rich interaction domain 1A
Synonyms: Osa1, 1110030E03Rik, Smarcf1, BAF250a
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 93760
Homologene: 21216
Gpbp1
Name: GC-rich promoter binding protein 1
Synonyms: 1700034P14Rik, D230035M11Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 73274
Homologene: 11292
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 9,886,002 bp
  • T to C, chromosome 1 at 169,525,385 bp
  • A to T, chromosome 2 at 26,440,703 bp
  • A to T, chromosome 2 at 31,152,359 bp
  • T to C, chromosome 2 at 66,534,223 bp
  • T to A, chromosome 2 at 112,156,162 bp
  • C to T, chromosome 2 at 126,783,298 bp
  • C to A, chromosome 2 at 146,388,486 bp
  • A to T, chromosome 3 at 93,279,945 bp
  • G to T, chromosome 3 at 94,958,348 bp
  • G to A, chromosome 3 at 142,564,162 bp
  • C to A, chromosome 4 at 80,911,510 bp
  • T to C, chromosome 4 at 96,475,550 bp
  • T to A, chromosome 4 at 133,486,207 bp
  • TGCCGCCGCCGCCGCCGCCGCCG to TGCCGCCGCCGCCGCCGCCG, chromosome 4 at 133,753,233 bp
  • G to T, chromosome 5 at 37,466,781 bp
  • T to C, chromosome 5 at 45,453,773 bp
  • G to C, chromosome 5 at 67,263,787 bp
  • T to A, chromosome 5 at 100,695,529 bp
  • A to G, chromosome 6 at 125,186,156 bp
  • C to T, chromosome 7 at 14,470,053 bp
  • A to T, chromosome 7 at 35,295,313 bp
  • A to G, chromosome 7 at 54,835,829 bp
  • A to G, chromosome 7 at 66,406,083 bp
  • A to T, chromosome 7 at 85,951,942 bp
  • G to T, chromosome 7 at 102,097,329 bp
  • A to G, chromosome 7 at 105,122,266 bp
  • T to C, chromosome 7 at 141,327,470 bp
  • T to C, chromosome 7 at 142,490,352 bp
  • T to C, chromosome 8 at 3,479,049 bp
  • A to T, chromosome 8 at 24,550,810 bp
  • A to T, chromosome 8 at 40,826,312 bp
  • A to G, chromosome 8 at 83,664,133 bp
  • T to C, chromosome 10 at 82,378,944 bp
  • T to A, chromosome 11 at 49,019,273 bp
  • A to G, chromosome 11 at 50,833,794 bp
  • T to C, chromosome 11 at 51,268,780 bp
  • T to A, chromosome 11 at 52,119,253 bp
  • A to T, chromosome 11 at 85,051,234 bp
  • G to A, chromosome 11 at 87,889,765 bp
  • C to T, chromosome 11 at 120,620,485 bp
  • G to C, chromosome 12 at 35,092,913 bp
  • A to G, chromosome 12 at 83,796,146 bp
  • A to G, chromosome 12 at 108,881,056 bp
  • T to C, chromosome 12 at 113,932,029 bp
  • A to G, chromosome 13 at 37,941,632 bp
  • A to G, chromosome 13 at 42,156,338 bp
  • A to T, chromosome 13 at 62,492,390 bp
  • A to G, chromosome 13 at 68,668,639 bp
  • A to G, chromosome 13 at 108,271,848 bp
  • A to G, chromosome 13 at 111,440,699 bp
  • C to T, chromosome 13 at 120,241,051 bp
  • A to T, chromosome 14 at 44,858,944 bp
  • A to T, chromosome 14 at 51,009,785 bp
  • G to C, chromosome 14 at 54,633,492 bp
  • A to C, chromosome 14 at 75,032,013 bp
  • TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG to TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG, chromosome 15 at 5,098,691 bp
  • A to G, chromosome 15 at 79,125,375 bp
  • A to G, chromosome 15 at 94,322,808 bp
  • A to T, chromosome 15 at 101,487,202 bp
  • T to C, chromosome 16 at 13,692,507 bp
  • T to C, chromosome 16 at 33,731,664 bp
  • C to T, chromosome 17 at 31,603,198 bp
  • A to C, chromosome 18 at 3,122,661 bp
  • G to A, chromosome 18 at 34,637,122 bp
  • A to G, chromosome 18 at 36,045,920 bp
  • T to A, chromosome 18 at 61,220,606 bp
  • A to T, chromosome 19 at 21,395,205 bp
  • C to A, chromosome 19 at 41,871,305 bp
  • A to G, chromosome Y at 825,537 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7186 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045271-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.