Strain Name:
C57BL/6J-MtgxR7208Btlr/Mmmh
Stock Number:
045285-MU
Citation ID:
RRID:MMRRC_045285-MU
Other Names:
R7208 (G1)
Major Collection:

Strain Information

Wasf2
Name: WASP family, member 2
Synonyms: D4Ertd13e, WAVE2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242687
Homologene: 86743
Rgs16
Name: regulator of G-protein signaling 16
Synonyms: Rgsr
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19734
HGNC: HGNC:9997
Homologene: 2196
Atm
Name: ataxia telangiectasia mutated
Synonyms: C030026E19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11920
HGNC: HGNC:795
Homologene: 30952
Dtx4
Name: deltex 4, E3 ubiquitin ligase
Synonyms: RNF155
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 207521
VEGA: 19
Homologene: 27781
Lemd2
Name: LEM domain containing 2
Synonyms: Lem2, NET25
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224640
VEGA: 17
Homologene: 17136
Stau1
Name: staufen double-stranded RNA binding protein 1
Synonyms: 5830401L18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20853
Homologene: 3384
Grhl2
Name: grainyhead like transcription factor 2
Synonyms: BOM, 0610015A08Rik, Tcfcp2l3, grainyheadlike, clft3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 252973
HGNC: HGNC:2799
Homologene: 32616
Phf20l1
Name: PHD finger protein 20-like 1
Synonyms: CGI-72, E130113K22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239510
VEGA: 15
Homologene: 9341
Zfat
Name: zinc finger and AT hook domain containing
Synonyms: LOC380993, Zfp406, Zfat1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 380993
Homologene: 16829
Prpf4b
Name: pre-mRNA processing factor 4B
Synonyms: Prp4, Prpk, Prp4k
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19134
VEGA: 13
Homologene: 134085
Nckap1
Name: NCK-associated protein 1
Synonyms: mh19, Hem-2, H19, Nap1, Hem2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 50884
HGNC: HGNC:7666
Homologene: 8384
Brwd1
Name: bromodomain and WD repeat domain containing 1
Synonyms: 5330419I02Rik, D530019K20Rik, G1-403-16, Wdr9, repro5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 93871
Homologene: 23130
Txlna
Name: taxilin alpha
Synonyms: 2600010N21Rik, Txln, IL14
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 109658
Homologene: 14062
Mcm5
Name: minichromosome maintenance complex component 5
Synonyms: mCD46, Cdc46, Mcmd5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17218
HGNC: HGNC:6948
Homologene: 4904
Gtf2ird1
Name: general transcription factor II I repeat domain-containing 1
Synonyms: WBSCR11, Cream1, GTF3, MusTRD1, binding factor for early enhancer, BEN, ESTM9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57080
HGNC: HGNC:4661
Homologene: 4158
Tep1
Name: telomerase associated protein 1
Synonyms: Tp1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21745
VEGA: 14
Homologene: 5157
Ctnnd1
Name: catenin delta 1
Synonyms: P120, Ctnnd, p120-catenin, Catns, catenin (cadherin associated protein), delta 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12388
HGNC: HGNC:2515
Homologene: 1017
Dclk2
Name: doublecortin-like kinase 2
Synonyms: 6330415M09Rik, Click-II, Dcamkl2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70762
Homologene: 69431
Swi5
Name: SWI5 recombination repair homolog (yeast)
Synonyms: 1500019F05Rik, 2900010J23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72931
Homologene: 128744
Zbtb40
Name: zinc finger and BTB domain containing 40
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230848
Homologene: 8912
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Ccdc80
Name: coiled-coil domain containing 80
Synonyms: Urb, Ssg1, 2610001E17Rik, DRO1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67896
Homologene: 12206
Stk3
Name: serine/threonine kinase 3
Synonyms: mess1, 0610042I06Rik, Mst2, MST, Ste20
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 56274
Homologene: 48420
Wdr62
Name: WD repeat domain 62
Synonyms: 2310038K02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233064
Homologene: 15927
Calcr
Name: calcitonin receptor
Synonyms: Clr
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12311
HGNC: HGNC:1440
Homologene: 1320
Grm7
Name: glutamate receptor, metabotropic 7
Synonyms: mGluR7, Gpr1g, E130018M02Rik, 6330570A01Rik, mGlu7a receptor
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108073
HGNC: HGNC:4599
Homologene: 20233
Robo3
Name: roundabout guidance receptor 3
Synonyms: Rig-1, Rbig1, Robo3b, Robo3a, Rig1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19649
Homologene: 32119
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, Dnchc2, b2b414Clo, m407Asp, m152Asp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
D16Ertd472e
Name: DNA segment, Chr 16, ERATO Doi 472, expressed
Synonyms: 2310009O17Rik, E330003K22Rik, 1700010I10Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67102
Homologene: 9696
Lnpep
Name: leucyl/cystinyl aminopeptidase
Synonyms: gp160, vp165, IRAP, 4732490P18Rik, 2010309L07Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240028
VEGA: 17
HGNC: HGNC:6656
Homologene: 21148
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Slc11a2
Name: solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2
Synonyms: DMT1, DCT1, van, Nramp2, microcytic anemia, viable anaemia
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18174
Homologene: 55471
Med28
Name: mediator complex subunit 28
Synonyms: Eg1, 1500003D12Rik, magicin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66999
Homologene: 11873
Kcnu1
Name: potassium channel, subfamily U, member 1
Synonyms: Slo3, Kcnma3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16532
Homologene: 7392
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, Cpfl8, diminished cone electroretinogram, dice
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319565
Homologene: 56700
Wdr95
Name: WD40 repeat domain 95
Synonyms: 4930434E21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381693
Homologene: 124480
Cntn3
Name: contactin 3
Synonyms: Pang
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18488
HGNC: HGNC:2173
Homologene: 7461
Pde9a
Name: phosphodiesterase 9A
Synonyms: PDE9A1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18585
HGNC: HGNC:8795
Homologene: 113565
Hrc
Name: histidine rich calcium binding protein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15464
HGNC: HGNC:5178
Homologene: 137234
Skint5
Name: selection and upkeep of intraepithelial T cells 5
Synonyms: OTTMUSG00000008560
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242627
Homologene: 135888
Vmn2r26
Name: vomeronasal 2, receptor 26
Synonyms: V2r1b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56552
Homologene: 135915
Synm
Name: synemin, intermediate filament protein
Synonyms: 4930412K21Rik, Synemin, Dmn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233335
Homologene: 9081
Ankhd1
Name: ankyrin repeat and KH domain containing 1
Synonyms: 1110004O12Rik, 9130019P20Rik, 4933432B13Rik, A530027J04Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 108857
Homologene: 87006
Ache
Name: acetylcholinesterase
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11423
HGNC: HGNC:108
Homologene: 543
Slc15a2
Name: solute carrier family 15 (H+/peptide transporter), member 2
Synonyms: Pept2, 8430408C16Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 57738
Homologene: 56912
Scara3
Name: scavenger receptor class A, member 3
Synonyms: C130058N24Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219151
VEGA: 14
Homologene: 9437
Dnai4
Name: dynein axonemal intermediate chain 4
Synonyms: Wdr78
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242584
Homologene: 11702
Acot12
Name: acyl-CoA thioesterase 12
Synonyms: 1300004O04Rik, 4930449F15Rik, Cach
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 74156
Homologene: 12540
Prmt8
Name: protein arginine N-methyltransferase 8
Synonyms: Hrmt1l3, Hrmt1l4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381813
HGNC: HGNC:5188
Homologene: 76124
Dnai2
Name: dynein axonemal intermediate chain 2
Synonyms: C030015H18Rik, Dnaic2, b2b3405Clo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432611
Homologene: 11311
Ly6g6c
Name: lymphocyte antigen 6 family member G6C
Synonyms: 1110003M04Rik, NG24, G6c
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68468
Homologene: 11350
Prorp
Name: protein only RNase P catalytic subunit
Synonyms: Mrpp3, 1110008L16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66132
Homologene: 45935
Tmc6
Name: transmembrane channel-like gene family 6
Synonyms: EVER1, D11Ertd204e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217353
Homologene: 5258
Aass
Name: aminoadipate-semialdehyde synthase
Synonyms: LOR/SDH, Lorsdh
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 30956
Homologene: 4212
Dmwd
Name: dystrophia myotonica-containing WD repeat motif
Synonyms: 59, DMR-N9, Dm9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13401
HGNC: HGNC:2936
Homologene: 22559
Cdh20
Name: cadherin 20
Synonyms: Cdh7
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23836
HGNC: HGNC:1760
Homologene: 8015
Fcgbp
Name: Fc fragment of IgG binding protein
Synonyms: A430096B05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 215384
Homologene: 68369
Nid1
Name: nidogen 1
Synonyms: entactin, entactin 1, nidogen-1, entactin-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18073
VEGA: 13
HGNC: HGNC:7821
Homologene: 1878
Acox2
Name: acyl-Coenzyme A oxidase 2, branched chain
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 93732
HGNC: HGNC:120
Homologene: 74473
Abcd2
Name: ATP-binding cassette, sub-family D member 2
Synonyms: ALDR, ALDL1, adrenoleukodystrophy related, ABC39
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 26874
VEGA: 15
HGNC: HGNC:66
Homologene: 55873
Tmem214
Name: transmembrane protein 214
Synonyms: 4921530J21Rik, 1110039B18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68796
Homologene: 9801
Adam3
Name: ADAM metallopeptidase domain 3
Synonyms: Taz83, tMDC, Cyrn1, ADAM3, Taz83
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11497
HGNC: HGNC:209
Homologene: 69052
Skint11
Name: selection and upkeep of intraepithelial T cells 11
Synonyms: A630098G03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230623
Homologene: 136292
Ccdc112
Name: coiled-coil domain containing 112
Synonyms: 8430438M01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240261
VEGA: 18
Homologene: 17617
Or12k8
Name: olfactory receptor family 12 subfamily K member 8
Synonyms: GA_x6K02T2NLDC-33777519-33776551, MOR159-3, Olfr361
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258365
Homologene: 27142
Fndc3c1
Name: fibronectin type III domain containing 3C1
Synonyms: LOC333564
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 333564
Homologene: 46440
Nkain3
Name: Na+/K+ transporting ATPase interacting 3
Synonyms: E130310K16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269513
Homologene: 18265
Arhgap27
Name: Rho GTPase activating protein 27
Synonyms: 2310069I04Rik, 5730442P18Rik, Sh3d20
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 544817
Homologene: 45715
Tnnt2
Name: troponin T2, cardiac
Synonyms: Tnt, cTnT, cardiac TnT
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21956
Homologene: 68050
Pdlim2
Name: PDZ and LIM domain 2
Synonyms: mystique, SLIM, 4732462F18Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 213019
Homologene: 11006
Gvin2
Name: GTPase, very large interferon inducible, family member 2
Synonyms: Gm4070
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100042856
Homologene: 32708
B4galt4
Name: UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 4
Synonyms: 9130402O08Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 56375
HGNC: HGNC:927
Homologene: 37848
Lrfn1
Name: leucine rich repeat and fibronectin type III domain containing 1
Synonyms: SALM2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80749
Homologene: 12729
Psmd6
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 6
Synonyms: 2400006A19Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66413
HGNC: HGNC:9564
Homologene: 7157
Serpina1b
Name: serine (or cysteine) preptidase inhibitor, clade A, member 1B
Synonyms: PI2, D12Ucla2, Spi1-2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20701
HGNC: HGNC:8941
Homologene: 20103
Hmgcs1
Name: 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1
Synonyms: B130032C06Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 208715
VEGA: 13
HGNC: HGNC:5007
Homologene: 1609
Mup11
Name: major urinary protein 11
Synonyms: Gm12549
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100039028
Homologene: 74304
Gm9195
Name: predicted gene 9195
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 675947
Homologene: 139067
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 104,954,071 bp
  • T to A, chromosome 1 at 135,850,376 bp
  • T to C, chromosome 1 at 153,741,670 bp
  • A to T, chromosome 2 at 32,287,910 bp
  • A to G, chromosome 2 at 37,085,658 bp
  • A to G, chromosome 2 at 80,540,198 bp
  • G to T, chromosome 2 at 84,622,046 bp
  • A to G, chromosome 2 at 166,963,574 bp
  • A to T, chromosome 3 at 86,799,602 bp
  • A to G, chromosome 4 at 20,282,892 bp
  • A to G, chromosome 4 at 60,659,726 bp
  • T to G, chromosome 4 at 103,066,352 bp
  • T to A, chromosome 4 at 113,539,339 bp
  • T to A, chromosome 4 at 114,231,747 bp
  • A to G, chromosome 4 at 129,631,278 bp
  • G to A, chromosome 4 at 133,195,734 bp
  • A to T, chromosome 4 at 136,999,626 bp
  • T to A, chromosome 5 at 30,870,721 bp
  • A to T, chromosome 5 at 45,523,452 bp
  • T to C, chromosome 5 at 134,411,094 bp
  • G to A, chromosome 5 at 137,291,489 bp
  • C to T, chromosome 5 at 149,595,371 bp
  • T to C, chromosome 6 at 3,687,612 bp
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp
  • T to C, chromosome 6 at 23,074,630 bp
  • G to A, chromosome 6 at 102,278,422 bp
  • T to G, chromosome 6 at 111,358,569 bp
  • T to C, chromosome 6 at 124,061,989 bp
  • C to T, chromosome 6 at 127,689,829 bp
  • C to T, chromosome 7 at 19,080,309 bp
  • T to A, chromosome 7 at 28,104,021 bp
  • A to G, chromosome 7 at 28,467,139 bp
  • C to T, chromosome 7 at 30,252,336 bp
  • A to T, chromosome 7 at 45,336,565 bp
  • T to C, chromosome 7 at 67,734,915 bp
  • A to C, chromosome 7 at 105,902,179 bp
  • C to A, chromosome 8 at 24,711,401 bp
  • C to T, chromosome 8 at 25,919,637 bp
  • T to C, chromosome 8 at 75,121,716 bp
  • C to A, chromosome 9 at 7,141,059 bp
  • A to T, chromosome 9 at 37,424,724 bp
  • A to T, chromosome 9 at 53,512,008 bp
  • C to T, chromosome 11 at 103,360,759 bp
  • T to C, chromosome 11 at 114,757,162 bp
  • A to G, chromosome 11 at 117,776,325 bp
  • A to G, chromosome 12 at 55,308,645 bp
  • A to T, chromosome 12 at 76,031,398 bp
  • T to A, chromosome 12 at 103,728,294 bp
  • G to C, chromosome 13 at 13,468,385 bp
  • T to A, chromosome 13 at 34,884,011 bp
  • T to C, chromosome 13 at 91,781,242 bp
  • G to T, chromosome 13 at 119,701,084 bp
  • T to G, chromosome 14 at 8,241,303 bp
  • A to T, chromosome 14 at 14,112,225 bp
  • T to A, chromosome 14 at 50,824,556 bp
  • C to T, chromosome 14 at 65,931,266 bp
  • T to A, chromosome 14 at 70,174,377 bp
  • A to G, chromosome 14 at 72,451,752 bp
  • G to T, chromosome 15 at 35,073,116 bp
  • A to C, chromosome 15 at 37,335,736 bp
  • T to C, chromosome 15 at 66,604,789 bp
  • T to C, chromosome 15 at 68,180,007 bp
  • G to T, chromosome 15 at 91,190,682 bp
  • T to C, chromosome 15 at 100,402,332 bp
  • T to C, chromosome 16 at 36,756,281 bp
  • T to A, chromosome 16 at 38,753,940 bp
  • T to G, chromosome 16 at 45,096,710 bp
  • A to T, chromosome 16 at 78,575,926 bp
  • T to G, chromosome 16 at 91,662,102 bp
  • C to T, chromosome 16 at 96,035,959 bp
  • A to T, chromosome 17 at 17,552,910 bp
  • G to A, chromosome 17 at 27,196,191 bp
  • G to A, chromosome 17 at 31,420,284 bp
  • A to G, chromosome 17 at 35,067,411 bp
  • T to C, chromosome 18 at 36,625,028 bp
  • T to C, chromosome 18 at 46,287,631 bp
  • C to T, chromosome 19 at 12,482,073 bp
  • G to C, chromosome X at 106,435,073 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7208 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045285-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.