Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7221Btlr/Mmmh
Stock Number:
045293-MU
Citation ID:
RRID:MMRRC_045293-MU
Other Names:
R7221 (G1)
Major Collection:

Strain Information

Rubcn
Name: RUN domain and cysteine-rich domain containing, Beclin 1-interacting protein
Synonyms: 1700021K19Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 100502698
Homologene: 15687
Emb
Name: embigin
Synonyms: Gp70
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13723
Homologene: 7743
Zic1
Name: zinc finger protein of the cerebellum 1
Synonyms: odd-paired homolog
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22771
Homologene: 2562
Hap1
Name: huntingtin-associated protein 1
Synonyms: HAP-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15114
HGNC: HGNC:4812
Homologene: 2935
Ipo11
Name: importin 11
Synonyms: E330021B14Rik, 1700081H05Rik, 2510001A17Rik, Ranbp11
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76582
Homologene: 7089
Thada
Name: thyroid adenoma associated
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240174
VEGA: 17
Homologene: 75175
Nsrp1
Name: nuclear speckle regulatory protein 1
Synonyms: NSpr70, Ccdc55
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237859
Homologene: 134095
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 46,455,777 bp
  • C to T, chromosome 1 at 72,650,231 bp
  • G to T, chromosome 1 at 93,137,901 bp
  • C to T, chromosome 1 at 150,446,178 bp
  • T to C, chromosome 1 at 158,266,547 bp
  • T to A, chromosome 2 at 35,151,857 bp
  • T to A, chromosome 2 at 76,941,851 bp
  • T to A, chromosome 2 at 88,487,629 bp
  • A to G, chromosome 2 at 88,973,153 bp
  • T to C, chromosome 2 at 89,609,928 bp
  • C to T, chromosome 2 at 120,300,995 bp
  • T to A, chromosome 2 at 140,661,170 bp
  • T to C, chromosome 2 at 156,373,661 bp
  • T to A, chromosome 2 at 157,229,917 bp
  • T to C, chromosome 2 at 177,834,610 bp
  • A to G, chromosome 3 at 59,928,933 bp
  • G to A, chromosome 3 at 87,086,397 bp
  • C to G, chromosome 3 at 94,703,826 bp
  • T to C, chromosome 3 at 94,994,189 bp
  • A to T, chromosome 3 at 106,131,920 bp
  • T to G, chromosome 3 at 108,475,001 bp
  • A to G, chromosome 3 at 117,620,969 bp
  • A to G, chromosome 4 at 11,225,613 bp
  • T to C, chromosome 4 at 11,961,004 bp
  • T to C, chromosome 4 at 115,635,978 bp
  • C to T, chromosome 4 at 118,431,614 bp
  • A to T, chromosome 5 at 31,187,787 bp
  • GAGGCTGGCAGCGTGTACGCAGGC to GAGGC, chromosome 5 at 33,732,748 bp
  • G to A, chromosome 5 at 121,630,210 bp
  • A to G, chromosome 6 at 89,747,052 bp
  • T to C, chromosome 6 at 97,112,724 bp
  • G to T, chromosome 6 at 119,236,663 bp
  • T to C, chromosome 6 at 135,228,531 bp
  • A to T, chromosome 7 at 15,626,058 bp
  • A to G, chromosome 7 at 118,182,797 bp
  • A to T, chromosome 8 at 18,990,972 bp
  • T to G, chromosome 8 at 69,522,664 bp
  • T to C, chromosome 8 at 111,933,676 bp
  • A to T, chromosome 9 at 8,100,987 bp
  • C to T, chromosome 9 at 18,642,199 bp
  • A to G, chromosome 9 at 38,855,242 bp
  • T to A, chromosome 9 at 49,069,712 bp
  • A to T, chromosome 9 at 64,118,935 bp
  • A to G, chromosome 9 at 91,364,732 bp
  • T to C, chromosome 9 at 92,584,527 bp
  • A to G, chromosome 9 at 113,852,757 bp
  • A to C, chromosome 10 at 13,247,039 bp
  • A to G, chromosome 10 at 23,895,054 bp
  • A to T, chromosome 10 at 79,480,167 bp
  • A to G, chromosome 11 at 50,863,043 bp
  • A to G, chromosome 11 at 72,456,916 bp
  • A to C, chromosome 11 at 76,423,161 bp
  • A to T, chromosome 11 at 77,048,423 bp
  • A to T, chromosome 11 at 86,288,095 bp
  • A to T, chromosome 11 at 100,348,829 bp
  • A to G, chromosome 11 at 104,900,606 bp
  • A to G, chromosome 11 at 106,382,442 bp
  • A to C, chromosome 11 at 107,054,832 bp
  • T to C, chromosome 13 at 21,703,102 bp
  • A to T, chromosome 13 at 106,892,557 bp
  • T to A, chromosome 13 at 117,267,477 bp
  • A to G, chromosome 14 at 27,653,158 bp
  • A to T, chromosome 14 at 50,654,071 bp
  • T to C, chromosome 14 at 61,208,806 bp
  • T to A, chromosome 14 at 66,869,232 bp
  • T to C, chromosome 14 at 72,556,157 bp
  • A to T, chromosome 15 at 73,586,410 bp
  • A to G, chromosome 15 at 76,175,774 bp
  • G to T, chromosome 15 at 102,029,532 bp
  • T to A, chromosome 16 at 4,482,947 bp
  • C to A, chromosome 16 at 14,142,485 bp
  • T to C, chromosome 16 at 32,866,923 bp
  • T to C, chromosome 16 at 35,953,701 bp
  • G to A, chromosome 17 at 32,359,165 bp
  • A to G, chromosome 17 at 37,805,561 bp
  • A to T, chromosome 17 at 46,528,565 bp
  • T to A, chromosome 17 at 78,842,117 bp
  • T to C, chromosome 17 at 84,464,366 bp
  • T to A, chromosome 18 at 39,773,910 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7221 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045293-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.