Strain Name:
C57BL/6J-MtgxR7222Btlr/Mmmh
Stock Number:
045294-MU
Citation ID:
RRID:MMRRC_045294-MU
Other Names:
R7222 (G1)
Major Collection:

Strain Information

Chrna5
Name: cholinergic receptor, nicotinic, alpha polypeptide 5
Synonyms: Acra5, Acra-5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110835
VEGA: 9
HGNC: HGNC:1959
Homologene: 55485
Tbce
Name: tubulin-specific chaperone E
Synonyms: 2610206D02Rik, C530005D02Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 70430
Homologene: 37744
Setd2
Name: SET domain containing 2
Synonyms: KMT3A, 4921524K10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235626
Homologene: 56493
Kif1b
Name: kinesin family member 1B
Synonyms: Kif1b alpha, KIF1Bp130, KIF1Bp204, Kif1b beta, A530096N05Rik, N-3 kinesin, D4Mil1e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16561
Homologene: 99835
Dop1a
Name: DOP1 leucine zipper like protein A
Synonyms: Dopey1, D9Ertd809e, B130005I07Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320615
Homologene: 26645
Sart3
Name: squamous cell carcinoma antigen recognized by T cells 3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 53890
Homologene: 40977
Ranbp3
Name: RAN binding protein 3
Synonyms: 2610024N24Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71810
VEGA: 17
HGNC: HGNC:9850
Homologene: 136516
Herc1
Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms: tbl, D130015N03Rik, 2810449H11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235439
HGNC: HGNC:4867
Homologene: 31207
Zfyve1
Name: zinc finger, FYVE domain containing 1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217695
VEGA: 12
Homologene: 10945
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: p600, D930005K06Rik, Zubr1, LOC381562, 1810009A16Rik, A930005E13Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69116
Homologene: 10804
Add3
Name: adducin 3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 27360
VEGA: 19
HGNC: HGNC:245
Homologene: 40893
Muc2
Name: mucin 2
Synonyms: 2010015E03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17831
HGNC: HGNC:7512
Homologene: 136755
Eva1c
Name: eva-1 homolog C
Synonyms: 1700092M14Rik, Fam176c, 4931408A02Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70967
Homologene: 14383
Tenm3
Name: teneurin transmembrane protein 3
Synonyms: 2610100B16Rik, Ten-m3, Odz3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23965
Homologene: 22673
Osbpl7
Name: oxysterol binding protein-like 7
Synonyms: 4933437E18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71240
Homologene: 79672
Terf2ip
Name: telomeric repeat binding factor 2, interacting protein
Synonyms: Rap1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 57321
Homologene: 10357
Slamf8
Name: SLAM family member 8
Synonyms: SBBI42, Blame, 5830408F06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74748
Homologene: 10589
Pde4d
Name: phosphodiesterase 4D, cAMP specific
Synonyms: Dpde3, dunce, 9630011N22Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238871
HGNC: HGNC:8783
Tmprss7
Name: transmembrane serine protease 7
Synonyms: LOC385645, matriptase-3, B230219I23Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208171
Homologene: 18178
Muc6
Name: mucin 6, gastric
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 353328
HGNC: HGNC:7517
Homologene: 18768
Dnah3
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381917
HGNC: HGNC:2949
Homologene: 19674
Polq
Name: polymerase (DNA directed), theta
Synonyms: A430110D14Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 77782
HGNC: HGNC:9186
Homologene: 32727
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
Atp7b
Name: ATPase, Cu++ transporting, beta polypeptide
Synonyms: WND, Wilson protein, Atp7a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11979
HGNC: HGNC:870
Homologene: 20063
Flg
Name: filaggrin
Synonyms: ft, profilaggrin, fillagrin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14246
VEGA: 3
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: E130113P14Rik, bl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
Trim30a
Name: tripartite motif-containing 30A
Synonyms: Rpt-1, Rpt1, Trim30
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20128
Homologene: 114426
Ankar
Name: ankyrin and armadillo repeat containing
Synonyms: 4932422E22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 319695
Homologene: 85163
Myo1h
Name: myosin 1H
Synonyms: 4631401O15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231646
Homologene: 82639
Arhgef10l
Name: Rho guanine nucleotide exchange factor 10-like
Synonyms: 2810441C07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72754
Homologene: 10017
Abca6
Name: ATP-binding cassette, sub-family A member 6
Synonyms: 6330565N06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76184
HGNC: HGNC:36
Homologene: 71264
P2ry14
Name: purinergic receptor P2Y, G-protein coupled, 14
Synonyms: Gpr105, P2Y14, A330108O13Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 140795
Homologene: 15769
Zfp948
Name: zinc finger protein 948
Synonyms: BC049807
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381066
VEGA: 17
Slc39a10
Name: solute carrier family 39 (zinc transporter), member 10
Synonyms: Zip10, 2900042E17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227059
Homologene: 34076
Cyp3a59
Name: cytochrome P450, family 3, subfamily a, polypeptide 59
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100041449
Homologene: 135775
Or52n4
Name: olfactory receptor family 52 subfamily N member 4
Synonyms: Olfr658, GA_x6K02T2PBJ9-7273558-7272587, MOR34-5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259051
Homologene: 105161
Clip1
Name: CAP-GLY domain containing linker protein 1
Synonyms: 4631429H07Rik, Clip50, cytoplasmic linker protein 50, restin, Rsn, 1110007I12Rik, Clip 170, CLIP-170
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56430
Homologene: 74455
Lztr1
Name: leucine-zipper-like transcriptional regulator, 1
Synonyms: TCFL2, 1200003E21Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66863
HGNC: HGNC:6742
Homologene: 4925
Ifi35
Name: interferon-induced protein 35
Synonyms: IFP35, 2010008K16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70110
HGNC: HGNC:5399
Homologene: 4040
Or7g31
Name: olfactory receptor family 7 subfamily G member 31
Synonyms: GA_x6K02T2PVTD-13214162-13213224, Olfr850, MOR147-2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258516
HGNC: HGNC:8466
Homologene: 121552
Or5d43
Name: olfactory receptor family 5 subfamily D member 43
Synonyms: MOR174-20_p, Olfr1173, GA_x6K02T2Q125-49759783-49758845
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 404329
Homologene: 128091
Or10v5
Name: olfactory receptor family 10 subfamily V member 5
Synonyms: Olfr1417, GA_x6K02T2RE5P-2172809-2171862, MOR266-2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258938
Homologene: 27304
Mmd2
Name: monocyte to macrophage differentiation-associated 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75104
Homologene: 18425
Or6c219
Name: olfactory receptor family 6 subfamily C member 219
Synonyms: GA_x6K02T2PULF-11624146-11623190, MOR110-2, Olfr818
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258773
Homologene: 74100
Or5p72
Name: olfactory receptor family 5 subfamily P member 72
Synonyms: GA_x6K02T2PBJ9-10752603-10753547, Olfr497, MOR204-9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258733
Homologene: 133602
Or51ag1
Name: olfactory receptor family 51 subfamily AG member 1
Synonyms: MOR9-2, GA_x6K02T2PBJ9-6221839-6220892, Olfr610
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259085
Homologene: 17495
Unc93a2
Name: unc-93 homolog A2
Synonyms: Gm9992
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 667055
VEGA: 17
Homologene: 10356
Speer1e
Name: spermatogenesis associated glutamate (E)-rich protein 1E
Synonyms: Gm5861
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 545728
Selenon
Name: selenoprotein N
Synonyms: Sepn1, 1110019I12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74777
Homologene: 10723
Igkv1-117
Name: immunoglobulin kappa variable 1-117
Synonyms: Gm16797
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16098
Traj49
Name: T cell receptor alpha joining 49
Synonyms: Gm17012
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100124339
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 46,819,292 bp
  • A to G, chromosome 1 at 72,666,355 bp
  • G to A, chromosome 1 at 172,584,208 bp
  • A to G, chromosome 2 at 82,983,671 bp
  • T to A, chromosome 2 at 88,274,465 bp
  • T to C, chromosome 3 at 59,115,382 bp
  • T to A, chromosome 3 at 93,288,314 bp
  • T to A, chromosome 4 at 134,547,977 bp
  • T to A, chromosome 4 at 139,463,373 bp
  • C to A, chromosome 4 at 140,521,269 bp
  • T to C, chromosome 4 at 149,225,157 bp
  • T to A, chromosome 5 at 11,183,113 bp
  • T to C, chromosome 5 at 96,636,186 bp
  • A to T, chromosome 5 at 96,636,809 bp
  • T to C, chromosome 5 at 113,746,656 bp
  • G to A, chromosome 5 at 114,355,261 bp
  • T to A, chromosome 5 at 123,611,841 bp
  • G to T, chromosome 5 at 142,567,927 bp
  • A to T, chromosome 5 at 146,096,575 bp
  • A to T, chromosome 6 at 68,121,749 bp
  • A to G, chromosome 7 at 103,506,457 bp
  • T to C, chromosome 7 at 104,421,432 bp
  • T to C, chromosome 7 at 104,644,730 bp
  • A to G, chromosome 7 at 108,422,637 bp
  • T to A, chromosome 7 at 120,071,523 bp
  • T to A, chromosome 7 at 141,634,515 bp
  • A to T, chromosome 7 at 141,704,209 bp
  • G to A, chromosome 8 at 22,022,378 bp
  • C to T, chromosome 8 at 48,300,969 bp
  • T to C, chromosome 8 at 112,011,915 bp
  • A to T, chromosome 9 at 19,477,467 bp
  • A to G, chromosome 9 at 54,998,063 bp
  • C to A, chromosome 9 at 66,467,499 bp
  • T to C, chromosome 9 at 86,522,876 bp
  • T to A, chromosome 9 at 110,551,462 bp
  • A to G, chromosome 10 at 129,945,889 bp
  • A to G, chromosome 11 at 97,060,538 bp
  • A to G, chromosome 11 at 101,457,515 bp
  • A to T, chromosome 11 at 110,191,693 bp
  • A to G, chromosome 12 at 83,555,005 bp
  • T to C, chromosome 13 at 13,998,150 bp
  • A to T, chromosome 13 at 109,757,579 bp
  • A to T, chromosome 14 at 54,168,703 bp
  • A to G, chromosome 16 at 17,524,132 bp
  • G to T, chromosome 16 at 37,086,633 bp
  • T to C, chromosome 16 at 45,690,893 bp
  • AGGGTGTCCTGTACGAAGGACTTCCGGG to AGGG, chromosome 16 at 90,904,184 bp
  • A to G, chromosome 17 at 7,376,467 bp
  • T to A, chromosome 17 at 21,587,840 bp
  • T to G, chromosome 17 at 56,710,211 bp
  • C to A, chromosome 19 at 11,828,657 bp
  • T to C, chromosome 19 at 53,216,846 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7222 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045294-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.