Strain Name:
C57BL/6J-MtgxR7232Btlr/Mmmh
Stock Number:
045303-MU
Citation ID:
RRID:MMRRC_045303-MU
Other Names:
R7232 (G1)
Major Collection:

Strain Information

Cd86
Name: CD86 antigen
Synonyms: B7-2, MB7-2, B70, Ly-58, Cd28l2, B7.2, Ly58
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12524
HGNC: HGNC:1705
Homologene: 10443
Kcnc1
Name: potassium voltage gated channel, Shaw-related subfamily, member 1
Synonyms: Kv3.1, KV4, NGK2, KShIIIB, Shaw, Kcr2-1, C230009H10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16502
HGNC: HGNC:6233
Homologene: 68134
Ncam2
Name: neural cell adhesion molecule 2
Synonyms: RNCAM, R4B12 antigen, Ncam-2, Ocam
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17968
HGNC: HGNC:7657
Homologene: 3336
Epha7
Name: Eph receptor A7
Synonyms: MDK1, Ebk, Cek11, Ehk3, Hek11, Mdk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13841
HGNC: HGNC:3390
Homologene: 20935
Slit3
Name: slit guidance ligand 3
Synonyms: Slit1, b2b2362.1Clo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20564
Homologene: 2303
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 0610038M01Rik, 2610510B01Rik, Dopey2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Arhgef10
Name: Rho guanine nucleotide exchange factor 10
Synonyms: 6430549H08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234094
Homologene: 22827
Pias2
Name: protein inhibitor of activated STAT 2
Synonyms: Dib, 6330408K17Rik, ARIP3, PIASxbeta, PIASxalpha, PIASxb, Miz1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17344
VEGA: 18
Homologene: 20979
U2surp
Name: U2 snRNP-associated SURP domain containing
Synonyms: 2610101N10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67958
Homologene: 13964
Ticrr
Name: TOPBP1-interacting checkpoint and replication regulator
Synonyms: 5730590G19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77011
Homologene: 67120
Cdc5l
Name: cell division cycle 5-like
Synonyms: 1200002I02Rik, PCDC5RP
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71702
VEGA: 17
HGNC: HGNC:1743
Homologene: 13291
Bop1
Name: block of proliferation 1
Synonyms: Erb1p
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12181
VEGA: 15
Homologene: 6612
Eif4enif1
Name: eukaryotic translation initiation factor 4E nuclear import factor 1
Synonyms: Clast4, 2610509L04Rik, D11Ertd166e, A930019J01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74203
Homologene: 10522
Ptpn21
Name: protein tyrosine phosphatase, non-receptor type 21
Synonyms: PTPD1, PTPRL10
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 24000
VEGA: 12
HGNC: HGNC:9651
Homologene: 5110
Fbxo15
Name: F-box protein 15
Synonyms: Fbx15, ecat3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 50764
VEGA: 18
Homologene: 17644
Chek2
Name: checkpoint kinase 2
Synonyms: CHK2, Rad53
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 50883
Homologene: 38289
Tep1
Name: telomerase associated protein 1
Synonyms: Tp1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21745
VEGA: 14
Homologene: 5157
Aqr
Name: aquarius
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11834
Homologene: 7629
Sox8
Name: SRY (sex determining region Y)-box 8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20681
Homologene: 7950
Vps13b
Name: vacuolar protein sorting 13B
Synonyms: 1810042B05Rik, Coh1, C330002D13Rik, 2310042E16Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 666173
VEGA: 15
HGNC: HGNC:2183
Homologene: 49516
Serpina3c
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3C
Synonyms: Kalbp, 1A1, Klkbp, alpha-1 antiproteinase
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16625
HGNC: HGNC:16
Homologene: 111129
Runx2
Name: runt related transcription factor 2
Synonyms: AML3, polyomavirus enhancer binding factor 2 (PEBP2), SL3-3 enhancer factor 1, PEBP2 alpha A, PEBP2aA, Osf2, Cbfa1, Pebpa2a
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12393
Homologene: 68389
Hgfac
Name: hepatocyte growth factor activator
Synonyms: HGFA
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 54426
HGNC: HGNC:4894
Homologene: 1170
Tenm3
Name: teneurin transmembrane protein 3
Synonyms: Ten-m3, 2610100B16Rik, Odz3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23965
Homologene: 22673
Ctps1
Name: cytidine 5'-triphosphate synthase 1
Synonyms: Ctps
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 51797
HGNC: HGNC:2519
Homologene: 20446
Tcf25
Name: transcription factor 25 (basic helix-loop-helix)
Synonyms: 1810041K11Rik, 1100001J13Rik, Nulp1, D8Ertd325e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66855
Homologene: 5701
Plxna2
Name: plexin A2
Synonyms: OCT, Plxn2, 2810428A13Rik, PlexA2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18845
HGNC: HGNC:9100
Homologene: 56427
Wnt5a
Name: wingless-type MMTV integration site family, member 5A
Synonyms: Wnt-5a, 8030457G12Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 22418
Homologene: 20720
Susd2
Name: sushi domain containing 2
Synonyms: 1200011D11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71733
VEGA: 10
Homologene: 10481
Lrp3
Name: low density lipoprotein receptor-related protein 3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 435965
HGNC: HGNC:6695
Homologene: 1745
Pak6
Name: p21 (RAC1) activated kinase 6
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214230
Homologene: 23200
Cfap46
Name: cilia and flagella associated protein 46
Synonyms: 9330101J02Rik, Ttc40
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 212124
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Myh13
Name: myosin, heavy polypeptide 13, skeletal muscle
Synonyms: extraocular myosin, EO Myosin, MyHC-eo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 544791
HGNC: HGNC:7571
Homologene: 55780
Dnah14
Name: dynein, axonemal, heavy chain 14
Synonyms: LOC381311, A230079K17Rik, Gm980, Dnahc14
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240960
HGNC: HGNC:2945
Homologene: 90078
Eogt
Name: EGF domain specific O-linked N-acetylglucosamine transferase
Synonyms: A130022J15Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101351
Homologene: 65276
Cntnap4
Name: contactin associated protein-like 4
Synonyms: Caspr4, E130114F09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 170571
Homologene: 24912
Sult2a3
Name: sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 3
Synonyms: Gm6955
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 629203
Homologene: 37741
Angpt4
Name: angiopoietin 4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11602
HGNC: HGNC:487
Homologene: 36302
Rp1
Name: retinitis pigmentosa 1 (human)
Synonyms: oxygen-regulated protein 1, Orp1, mG145, Dcdc3, Rp1h
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19888
Homologene: 4564
Naglu
Name: alpha-N-acetylglucosaminidase (Sanfilippo disease IIIB)
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 27419
HGNC: HGNC:7632
Homologene: 222
Gbe1
Name: 1,4-alpha-glucan branching enzyme 1
Synonyms: 2310045H19Rik, 2810426P10Rik, D16Ertd536e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74185
HGNC: HGNC:4180
Homologene: 129
Muc5b
Name: mucin 5, subtype B, tracheobronchial
Synonyms: MUC9, MUC5, 2300002I04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74180
HGNC: HGNC:7516
Homologene: 136756
Unc79
Name: unc-79 homolog
Synonyms: 9030205A07Rik, Mlca3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217843
Homologene: 41397
Gjd4
Name: gap junction protein, delta 4
Synonyms: connexin 39, Cx39, 9430022F06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225152
VEGA: 18
Homologene: 17692
Lgi4
Name: leucine-rich repeat LGI family, member 4
Synonyms: clp
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243914
Homologene: 16408
Or10a2
Name: olfactory receptor family 10 subfamily A member 2
Synonyms: GA_x6K02T2PBJ9-9453401-9454354, MOR263-2, P4, Olfr714
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259035
Homologene: 72055
Gfra3
Name: glial cell line derived neurotrophic factor family receptor alpha 3
Synonyms: GFR alpha-3, GFRalpha3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 14587
VEGA: 18
HGNC: HGNC:4245
Homologene: 1146
Prss36
Name: serine protease 36
Synonyms: polyserase-2, C330007D15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77613
Homologene: 18303
Usp13
Name: ubiquitin specific peptidase 13 (isopeptidase T-3)
Synonyms: IsoT-3, ISOT3, 2700071E21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72607
Homologene: 68372
Onecut2
Name: one cut domain, family member 2
Synonyms: OC-2, Oc2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225631
HGNC: HGNC:8139
Homologene: 113592
Ncan
Name: neurocan
Synonyms: Tgfbit, Cspg3, Cspg3-rs
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13004
HGNC: HGNC:2465
Homologene: 3229
Nkiras1
Name: NFKB inhibitor interacting Ras-like protein 1
Synonyms: KBRAS1, 2400004O09Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 69721
Homologene: 10670
Evi5l
Name: ecotropic viral integration site 5 like
Synonyms: 3110007G05Rik, 1700084G18Rik, 2310039H16Rik, B130050I23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 213027
Homologene: 134635
Scn11a
Name: sodium channel, voltage-gated, type XI, alpha
Synonyms: SNS2, NaN, NaT, NSS2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 24046
VEGA: 9
Homologene: 8041
Adam21
Name: a disintegrin and metallopeptidase domain 21
Synonyms: ADAM31
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56622
HGNC: HGNC:200
Homologene: 68365
Vcam1
Name: vascular cell adhesion molecule 1
Synonyms: CD106, Vcam-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22329
Homologene: 838
Vmn2r60
Name: vomeronasal 2, receptor 60
Synonyms: Casr-rs3, EG637898, Gprc2a-rs3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 637898
Homologene: 129683
Nlrp4c
Name: NLR family, pyrin domain containing 4C
Synonyms: Nalp-alpha, Rnh2, Nalp4c
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 83564
Homologene: 75315
Fam170a
Name: family with sequence similarity 170, member A
Synonyms: LOC225497, Znfd
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225497
VEGA: 18
Homologene: 86702
Tlr5
Name: toll-like receptor 5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 53791
Homologene: 20698
Tas2r106
Name: taste receptor, type 2, member 106
Synonyms: T2R06, Tas2r6, mGR06, mt2r44
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387341
Homologene: 130071
4930433I11Rik
Name: RIKEN cDNA 4930433I11 gene
Synonyms: LOC243944
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243944
Homologene: 77912
Zfp773
Name: zinc finger protein 773
Synonyms: 2810409K11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76373
Homologene: 137393
Krt6b
Name: keratin 6B
Synonyms: mK6[b], Krt2-6b
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16688
VEGA: 15
Homologene: 136794
Sox13
Name: SRY (sex determining region Y)-box 13
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20668
Homologene: 4159
Dpysl5
Name: dihydropyrimidinase-like 5
Synonyms: Crmp5, CRMP-5, CRAM
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 65254
Homologene: 41347
Ldha
Name: lactate dehydrogenase A
Synonyms: lactate dehydrogenase-A, LDH-A, Ldh-1, l7R2, Ldh1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16828
HGNC: HGNC:6535
Homologene: 56495
Sostdc1
Name: sclerostin domain containing 1
Synonyms: Sostl, ectodin, Wise, USAG-1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66042
VEGA: 12
Homologene: 9154
Zar1
Name: zygote arrest 1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 317755
Homologene: 18370
Adgrg7
Name: adhesion G protein-coupled receptor G7
Synonyms: 9130020O16Rik, Gpr128
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239853
Homologene: 13115
Marchf5
Name: membrane associated ring-CH-type finger 5
Synonyms: 2310008I22Rik, 1810015H18Rik, E130202O05Rik, MARCH-V, 2700055A20Rik, Rnf153, 5730499H23Rik, MITOL, March5
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 69104
Homologene: 9862
Lpar3
Name: lysophosphatidic acid receptor 3
Synonyms: LPA3, Edg7
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 65086
Homologene: 8123
Zhx1
Name: zinc fingers and homeoboxes 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 22770
Homologene: 5225
Duoxa1
Name: dual oxidase maturation factor 1
Synonyms: Nip1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 213696
Homologene: 16043
Rassf2
Name: Ras association (RalGDS/AF-6) domain family member 2
Synonyms: 3830431H01Rik, 9030412M04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 215653
HGNC: HGNC:9883
Homologene: 22840
Jakmip3
Name: janus kinase and microtubule interacting protein 3
Synonyms: 6330417G02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74004
Homologene: 90425
Defa27
Name: defensin, alpha, 27
Synonyms: ENSMUSG00000074438, Gm15299
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100041811
Homologene: 113382
Nscme3l
Name: NSE3 homolog, SMC5-SMC6 complex component like
Synonyms: 1700020D05Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 75555
HGNC: HGNC:7677
Homologene: 137364
Gm29106
Name: predicted gene 29106
Type: Gene
Species: Mouse
Chromosome: 1
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 4,228,601 bp
  • C to T, chromosome 1 at 118,199,561 bp
  • A to T, chromosome 1 at 133,384,391 bp
  • T to C, chromosome 1 at 181,757,363 bp
  • G to A, chromosome 1 at 182,973,499 bp
  • T to A, chromosome 1 at 194,712,260 bp
  • ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG to ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG, chromosome 2 at 76,915,806 bp
  • A to C, chromosome 2 at 114,105,882 bp
  • T to A, chromosome 2 at 118,693,522 bp
  • T to A, chromosome 2 at 122,305,247 bp
  • T to C, chromosome 2 at 131,996,412 bp
  • T to C, chromosome 2 at 151,929,540 bp
  • A to G, chromosome 3 at 32,865,871 bp
  • T to C, chromosome 3 at 116,125,979 bp
  • T to G, chromosome 3 at 146,241,306 bp
  • T to A, chromosome 4 at 28,951,279 bp
  • C to A, chromosome 4 at 120,548,124 bp
  • G to A, chromosome 5 at 30,792,298 bp
  • G to T, chromosome 5 at 35,046,914 bp
  • G to A, chromosome 5 at 72,580,951 bp
  • T to C, chromosome 5 at 110,860,915 bp
  • T to A, chromosome 6 at 97,119,983 bp
  • T to G, chromosome 6 at 131,678,847 bp
  • T to A, chromosome 7 at 6,065,709 bp
  • A to T, chromosome 7 at 7,132,985 bp
  • A to T, chromosome 7 at 14,082,760 bp
  • G to A, chromosome 7 at 31,067,351 bp
  • T to C, chromosome 7 at 35,206,052 bp
  • G to A, chromosome 7 at 40,993,179 bp
  • T to A, chromosome 7 at 42,136,742 bp
  • T to A, chromosome 7 at 46,427,959 bp
  • T to C, chromosome 7 at 46,850,899 bp
  • A to T, chromosome 7 at 79,693,742 bp
  • T to A, chromosome 7 at 107,073,855 bp
  • G to T, chromosome 7 at 127,935,591 bp
  • A to G, chromosome 7 at 139,007,626 bp
  • C to A, chromosome 7 at 139,617,577 bp
  • A to T, chromosome 7 at 141,866,129 bp
  • A to G, chromosome 8 at 4,205,906 bp
  • G to A, chromosome 8 at 14,940,323 bp
  • A to T, chromosome 8 at 21,315,609 bp
  • G to A, chromosome 8 at 48,235,935 bp
  • A to G, chromosome 8 at 70,112,088 bp
  • T to A, chromosome 8 at 112,665,099 bp
  • T to A, chromosome 8 at 123,401,061 bp
  • A to G, chromosome 9 at 95,493,717 bp
  • T to A, chromosome 9 at 119,759,916 bp
  • T to C, chromosome 10 at 75,639,851 bp
  • A to G, chromosome 11 at 3,215,678 bp
  • A to G, chromosome 11 at 35,610,689 bp
  • G to A, chromosome 11 at 67,348,846 bp
  • A to T, chromosome 11 at 101,076,426 bp
  • C to A, chromosome 12 at 36,317,311 bp
  • T to G, chromosome 12 at 81,560,556 bp
  • A to T, chromosome 12 at 98,688,737 bp
  • T to A, chromosome 12 at 103,134,475 bp
  • A to T, chromosome 12 at 104,149,512 bp
  • T to C, chromosome 14 at 18,276,732 bp
  • T to A, chromosome 14 at 28,518,372 bp
  • A to G, chromosome 14 at 50,844,332 bp
  • A to G, chromosome 15 at 35,877,557 bp
  • T to C, chromosome 15 at 58,053,069 bp
  • A to G, chromosome 15 at 76,453,346 bp
  • T to C, chromosome 15 at 101,678,142 bp
  • CA to CAA, chromosome 16 at 36,606,555 bp
  • T to C, chromosome 16 at 56,777,152 bp
  • T to C, chromosome 16 at 70,436,940 bp
  • T to A, chromosome 16 at 81,512,871 bp
  • T to G, chromosome 16 at 93,760,485 bp
  • G to T, chromosome 17 at 25,567,540 bp
  • G to A, chromosome 17 at 44,814,192 bp
  • A to G, chromosome 17 at 45,427,937 bp
  • C to T, chromosome 18 at 9,280,380 bp
  • C to T, chromosome 18 at 34,711,181 bp
  • T to C, chromosome 18 at 50,281,661 bp
  • T to A, chromosome 18 at 64,341,562 bp
  • A to G, chromosome 18 at 77,133,235 bp
  • T to C, chromosome 18 at 84,962,622 bp
  • A to T, chromosome 19 at 5,503,631 bp
  • G to A, chromosome 19 at 37,217,314 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7232 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045303-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.