Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7232Btlr/Mmmh
Stock Number:
045303-MU
Citation ID:
RRID:MMRRC_045303-MU
Other Names:
R7232 (G1)
Major Collection:

Strain Information

Cd86
Name: CD86 antigen
Synonyms: B7-2, MB7-2, B70, Ly-58, Cd28l2, B7.2, Ly58
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12524
HGNC: HGNC:1705
Homologene: 10443
Kcnc1
Name: potassium voltage gated channel, Shaw-related subfamily, member 1
Synonyms: Kv3.1, KV4, NGK2, KShIIIB, Kcr2-1, Shaw, C230009H10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16502
HGNC: HGNC:6233
Homologene: 68134
Ncam2
Name: neural cell adhesion molecule 2
Synonyms: RNCAM, R4B12 antigen, Ncam-2, Ocam
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17968
HGNC: HGNC:7657
Homologene: 3336
Epha7
Name: Eph receptor A7
Synonyms: MDK1, Ebk, Cek11, Ehk3, Hek11, Mdk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13841
HGNC: HGNC:3390
Homologene: 20935
Slit3
Name: slit guidance ligand 3
Synonyms: Slit1, b2b2362.1Clo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20564
Homologene: 2303
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 0610038M01Rik, 2610510B01Rik, Dopey2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Arhgef10
Name: Rho guanine nucleotide exchange factor 10
Synonyms: 6430549H08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234094
Homologene: 22827
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 4,228,601 bp
  • C to T, chromosome 1 at 118,199,561 bp
  • A to T, chromosome 1 at 133,384,391 bp
  • T to C, chromosome 1 at 181,757,363 bp
  • G to A, chromosome 1 at 182,973,499 bp
  • T to A, chromosome 1 at 194,712,260 bp
  • ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG to ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG, chromosome 2 at 76,915,806 bp
  • A to C, chromosome 2 at 114,105,882 bp
  • T to A, chromosome 2 at 118,693,522 bp
  • T to A, chromosome 2 at 122,305,247 bp
  • T to C, chromosome 2 at 131,996,412 bp
  • T to C, chromosome 2 at 151,929,540 bp
  • A to G, chromosome 3 at 32,865,871 bp
  • T to C, chromosome 3 at 116,125,979 bp
  • T to G, chromosome 3 at 146,241,306 bp
  • T to A, chromosome 4 at 28,951,279 bp
  • C to A, chromosome 4 at 120,548,124 bp
  • G to A, chromosome 5 at 30,792,298 bp
  • G to T, chromosome 5 at 35,046,914 bp
  • G to A, chromosome 5 at 72,580,951 bp
  • T to C, chromosome 5 at 110,860,915 bp
  • T to A, chromosome 6 at 97,119,983 bp
  • T to G, chromosome 6 at 131,678,847 bp
  • T to A, chromosome 7 at 6,065,709 bp
  • A to T, chromosome 7 at 7,132,985 bp
  • A to T, chromosome 7 at 14,082,760 bp
  • G to A, chromosome 7 at 31,067,351 bp
  • T to C, chromosome 7 at 35,206,052 bp
  • G to A, chromosome 7 at 40,993,179 bp
  • T to A, chromosome 7 at 42,136,742 bp
  • T to A, chromosome 7 at 46,427,959 bp
  • T to C, chromosome 7 at 46,850,899 bp
  • A to T, chromosome 7 at 79,693,742 bp
  • T to A, chromosome 7 at 107,073,855 bp
  • G to T, chromosome 7 at 127,935,591 bp
  • A to G, chromosome 7 at 139,007,626 bp
  • C to A, chromosome 7 at 139,617,577 bp
  • A to T, chromosome 7 at 141,866,129 bp
  • A to G, chromosome 8 at 4,205,906 bp
  • G to A, chromosome 8 at 14,940,323 bp
  • A to T, chromosome 8 at 21,315,609 bp
  • G to A, chromosome 8 at 48,235,935 bp
  • A to G, chromosome 8 at 70,112,088 bp
  • T to A, chromosome 8 at 112,665,099 bp
  • T to A, chromosome 8 at 123,401,061 bp
  • A to G, chromosome 9 at 95,493,717 bp
  • T to A, chromosome 9 at 119,759,916 bp
  • T to C, chromosome 10 at 75,639,851 bp
  • A to G, chromosome 11 at 3,215,678 bp
  • A to G, chromosome 11 at 35,610,689 bp
  • G to A, chromosome 11 at 67,348,846 bp
  • A to T, chromosome 11 at 101,076,426 bp
  • C to A, chromosome 12 at 36,317,311 bp
  • T to G, chromosome 12 at 81,560,556 bp
  • A to T, chromosome 12 at 98,688,737 bp
  • T to A, chromosome 12 at 103,134,475 bp
  • A to T, chromosome 12 at 104,149,512 bp
  • T to C, chromosome 14 at 18,276,732 bp
  • T to A, chromosome 14 at 28,518,372 bp
  • A to G, chromosome 14 at 50,844,332 bp
  • A to G, chromosome 15 at 35,877,557 bp
  • T to C, chromosome 15 at 58,053,069 bp
  • A to G, chromosome 15 at 76,453,346 bp
  • T to C, chromosome 15 at 101,678,142 bp
  • CA to CAA, chromosome 16 at 36,606,555 bp
  • T to C, chromosome 16 at 56,777,152 bp
  • T to C, chromosome 16 at 70,436,940 bp
  • T to A, chromosome 16 at 81,512,871 bp
  • T to G, chromosome 16 at 93,760,485 bp
  • G to T, chromosome 17 at 25,567,540 bp
  • G to A, chromosome 17 at 44,814,192 bp
  • A to G, chromosome 17 at 45,427,937 bp
  • C to T, chromosome 18 at 9,280,380 bp
  • C to T, chromosome 18 at 34,711,181 bp
  • T to C, chromosome 18 at 50,281,661 bp
  • T to A, chromosome 18 at 64,341,562 bp
  • A to G, chromosome 18 at 77,133,235 bp
  • T to C, chromosome 18 at 84,962,622 bp
  • A to T, chromosome 19 at 5,503,631 bp
  • G to A, chromosome 19 at 37,217,314 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7232 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045303-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.