Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7247Btlr/Mmmh
Stock Number:
045310-MU
Citation ID:
RRID:MMRRC_045310-MU
Other Names:
R7247 (G1)
Major Collection:

Strain Information

Camk2a
Name: calcium/calmodulin-dependent protein kinase II alpha
Synonyms: alpha-CaMKII
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12322
HGNC: HGNC:1460
Homologene: 56577
Marchf4
Name: membrane associated ring-CH-type finger 4
Synonyms: March4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381270
Homologene: 66199
Map3k8
Name: mitogen-activated protein kinase kinase kinase 8
Synonyms: Cot, Tpl2, c-COT, Tpl-2, Cot/Tpl2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 26410
HGNC: HGNC:6860
Homologene: 3812
Ezh2
Name: enhancer of zeste 2 polycomb repressive complex 2 subunit
Synonyms: Enx-1, Enx1h, KMT6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14056
HGNC: HGNC:3527
Homologene: 37926
Ltn1
Name: listerin E3 ubiquitin protein ligase 1
Synonyms: 4930528H02Rik, Zfp294, Listerin, Rnf160
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78913
VEGA: 16
Homologene: 32272
Cdk5rap2
Name: CDK5 regulatory subunit associated protein 2
Synonyms: 2900018K03Rik, an
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 214444
Homologene: 49533
Caprin1
Name: cell cycle associated protein 1
Synonyms: MMGPIP137, Gpiap1, caprin-1, RNG105
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 53872
HGNC: HGNC:6743
Homologene: 4310
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 72,452,478 bp
  • A to T, chromosome 1 at 119,690,034 bp
  • A to G, chromosome 1 at 155,910,753 bp
  • A to G, chromosome 1 at 170,965,700 bp
  • A to C, chromosome 1 at 181,112,286 bp
  • G to A, chromosome 2 at 41,269,212 bp
  • G to T, chromosome 2 at 52,258,741 bp
  • A to T, chromosome 2 at 83,724,835 bp
  • G to A, chromosome 2 at 90,252,821 bp
  • A to T, chromosome 2 at 103,779,474 bp
  • G to A, chromosome 2 at 105,937,056 bp
  • TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT to TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT, chromosome 2 at 121,397,572 bp
  • T to C, chromosome 2 at 161,533,523 bp
  • C to T, chromosome 2 at 164,825,799 bp
  • A to G, chromosome 3 at 30,140,356 bp
  • T to C, chromosome 3 at 96,041,405 bp
  • A to T, chromosome 4 at 25,254,637 bp
  • A to G, chromosome 4 at 59,690,502 bp
  • A to G, chromosome 4 at 70,337,429 bp
  • A to G, chromosome 4 at 126,152,115 bp
  • A to C, chromosome 4 at 154,667,423 bp
  • T to C, chromosome 5 at 108,703,499 bp
  • T to C, chromosome 5 at 120,585,250 bp
  • T to C, chromosome 6 at 47,533,774 bp
  • T to A, chromosome 6 at 69,631,858 bp
  • T to C, chromosome 6 at 90,384,173 bp
  • G to T, chromosome 6 at 112,665,325 bp
  • A to T, chromosome 7 at 31,303,596 bp
  • T to A, chromosome 7 at 34,675,936 bp
  • T to C, chromosome 7 at 37,569,206 bp
  • T to A, chromosome 7 at 102,421,532 bp
  • T to C, chromosome 7 at 102,742,344 bp
  • A to G, chromosome 8 at 19,903,421 bp
  • A to T, chromosome 8 at 105,284,699 bp
  • A to T, chromosome 9 at 19,537,333 bp
  • T to A, chromosome 9 at 39,144,857 bp
  • A to G, chromosome 9 at 86,792,616 bp
  • A to G, chromosome 9 at 95,560,193 bp
  • A to G, chromosome 9 at 107,548,777 bp
  • A to T, chromosome 9 at 111,367,512 bp
  • T to A, chromosome 10 at 18,625,391 bp
  • C to T, chromosome 10 at 76,272,532 bp
  • T to A, chromosome 10 at 121,869,790 bp
  • T to A, chromosome 10 at 128,042,598 bp
  • T to C, chromosome 10 at 129,410,182 bp
  • A to G, chromosome 11 at 9,290,732 bp
  • G to A, chromosome 11 at 34,714,513 bp
  • G to T, chromosome 11 at 59,103,318 bp
  • G to A, chromosome 11 at 115,801,896 bp
  • T to C, chromosome 12 at 81,725,830 bp
  • A to G, chromosome 13 at 25,102,391 bp
  • A to G, chromosome 13 at 112,336,253 bp
  • T to C, chromosome 14 at 16,416,962 bp
  • A to T, chromosome 14 at 54,360,855 bp
  • A to G, chromosome 14 at 70,577,982 bp
  • G to A, chromosome 15 at 16,778,255 bp
  • A to T, chromosome 15 at 63,833,334 bp
  • A to T, chromosome 15 at 76,177,343 bp
  • A to T, chromosome 16 at 14,127,093 bp
  • T to C, chromosome 16 at 17,139,691 bp
  • T to C, chromosome 16 at 18,456,072 bp
  • T to C, chromosome 16 at 19,065,441 bp
  • C to A, chromosome 16 at 37,947,741 bp
  • T to C, chromosome 16 at 87,409,387 bp
  • A to G, chromosome 16 at 96,820,808 bp
  • T to A, chromosome 17 at 24,720,580 bp
  • A to T, chromosome 17 at 34,572,517 bp
  • A to T, chromosome 17 at 43,475,104 bp
  • T to C, chromosome 18 at 4,334,036 bp
  • A to G, chromosome 18 at 60,943,205 bp
  • T to A, chromosome 19 at 6,077,389 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7247 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045310-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.