Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7247Btlr/Mmmh
Stock Number:
045310-MU
Citation ID:
RRID:MMRRC_045310-MU
Other Names:
R7247 (G1)
Major Collection:

Strain Information

Camk2a
Name: calcium/calmodulin-dependent protein kinase II alpha
Synonyms: alpha-CaMKII
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12322
HGNC: HGNC:1460
Homologene: 56577
Marchf4
Name: membrane associated ring-CH-type finger 4
Synonyms: March4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381270
Homologene: 66199
Map3k8
Name: mitogen-activated protein kinase kinase kinase 8
Synonyms: Cot, Tpl2, c-COT, Tpl-2, Cot/Tpl2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 26410
HGNC: HGNC:6860
Homologene: 3812
Ezh2
Name: enhancer of zeste 2 polycomb repressive complex 2 subunit
Synonyms: Enx-1, Enx1h, KMT6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14056
HGNC: HGNC:3527
Homologene: 37926
Ltn1
Name: listerin E3 ubiquitin protein ligase 1
Synonyms: 4930528H02Rik, Zfp294, Listerin, Rnf160
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78913
VEGA: 16
Homologene: 32272
Cdk5rap2
Name: CDK5 regulatory subunit associated protein 2
Synonyms: 2900018K03Rik, an
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 214444
Homologene: 49533
Caprin1
Name: cell cycle associated protein 1
Synonyms: MMGPIP137, Gpiap1, caprin-1, RNG105
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 53872
HGNC: HGNC:6743
Homologene: 4310
Nvl
Name: nuclear VCP-like
Synonyms: 1200009I24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67459
HGNC: HGNC:8070
Homologene: 1902
Cep350
Name: centrosomal protein 350
Synonyms: 6430546F08Rik, 4933409L06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74081
Homologene: 8879
Ufl1
Name: UFM1 specific ligase 1
Synonyms: Rcad, Maxer, 1810074P20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67490
Homologene: 9093
Marf1
Name: meiosis regulator and mRNA stability 1
Synonyms: 4921513D23Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 223989
VEGA: 16
Homologene: 40967
Snap91
Name: synaptosomal-associated protein 91
Synonyms: F1-20, 91kDa, AP180
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20616
Homologene: 8429
Dcdc2a
Name: doublecortin domain containing 2a
Synonyms: RU2, Dcdc2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 195208
Homologene: 9483
Naca
Name: nascent polypeptide-associated complex alpha polypeptide
Synonyms: skNAC, LOC380777
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17938
VEGA: 10
HGNC: HGNC:7629
Homologene: 136025
Cdh9
Name: cadherin 9
Synonyms: T1-cadherin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12565
HGNC: HGNC:1768
Homologene: 9450
Fgfrl1
Name: fibroblast growth factor receptor-like 1
Synonyms: fibroblast growth factor receptor 5, FGFR5gamma, FGFR5beta, FGFR5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 116701
HGNC: HGNC:3693
Homologene: 11067
Or51e2
Name: olfactory receptor family 51 subfamily E member 2
Synonyms: RA1c, PSGR, MOL2.3, 4633402A21Rik, MOR18-2, GA_x6K02T2PBJ9-5459657-5458695, Olfr78
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 170639
Homologene: 23713
Stim1
Name: stromal interaction molecule 1
Synonyms: SIM
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20866
Homologene: 20681
Vps51
Name: VPS51 GARP complex subunit
Synonyms: 3110057M17Rik, 1110014N23Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 68505
HGNC: HGNC:1172
Homologene: 34675
Zswim1
Name: zinc finger SWIM-type containing 1
Synonyms: 2410003H12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71971
Homologene: 12429
Tpcn1
Name: two pore channel 1
Synonyms: 5730403B01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 252972
Homologene: 9905
Ptpn4
Name: protein tyrosine phosphatase, non-receptor type 4
Synonyms: hPTP-MEG, protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte), TEP/mPTPMEG, testis-enriched phosphatase, TEP, PTPMEG
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19258
HGNC: HGNC:9656
Homologene: 2120
Mecom
Name: MDS1 and EVI1 complex locus
Synonyms: ZNFPR1B1, Prdm3, MDS1-EVI1, Evi-1, D630039M04Rik, Jbo, Evi1, Mds1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14013
HGNC: HGNC:3498
Homologene: 21086
Dock2
Name: dedicator of cyto-kinesis 2
Synonyms: MBC, CED-5, Hch
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 94176
HGNC: HGNC:2988
Homologene: 37984
Abca13
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268379
Homologene: 27991
Ccdc116
Name: coiled-coil domain containing 116
Synonyms: 4930432J16Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 76872
Homologene: 51873
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Dscam
Name: DS cell adhesion molecule
Synonyms: 4932410A21Rik, Down syndrome cell adhesion molecule
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13508
HGNC: HGNC:3039
Homologene: 74393
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Trank1
Name: tetratricopeptide repeat and ankyrin repeat containing 1
Synonyms: A230061D21Rik, LOC235639, C030048J01Rik, Lba1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320429
Homologene: 45845
Srgap1
Name: SLIT-ROBO Rho GTPase activating protein 1
Synonyms: 4930572H05Rik, Arhgap13
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 117600
Homologene: 56898
Ptprt
Name: protein tyrosine phosphatase receptor type T
Synonyms: RPTPrho
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19281
HGNC: HGNC:9682
Homologene: 56924
Zxdc
Name: ZXD family zinc finger C
Synonyms: B930086F11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 80292
Homologene: 82340
Scgb2b2
Name: secretoglobin, family 2B, member 2
Synonyms: Abpe, Abpbg2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381970
Homologene: 83171
Top2b
Name: topoisomerase (DNA) II beta
Synonyms: Top-2, D230016L12Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21974
Homologene: 134711
Arfgef3
Name: ARFGEF family member 3
Synonyms: B930094H20Rik, D10Bwg1379e, BIG3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215821
VEGA: 10
Homologene: 41366
Or8g19
Name: olfactory receptor family 8 subfamily G member 19
Synonyms: MTPCR56, MOR171-6, GA_x6K02T2PVTD-32841223-32842158, GA_x6K02T2KYVW-1037-120, Olfr242, Olfr27
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258826
VEGA: 9
HGNC: HGNC:8484
Homologene: 110610
Caskin2
Name: CASK-interacting protein 2
Synonyms: 1600028L06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 140721
Homologene: 32485
Notch4
Name: notch 4
Synonyms: Int-3, Int3, N4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18132
HGNC: HGNC:7884
Homologene: 3351
Mep1a
Name: meprin 1 alpha
Synonyms: meprin A alpha-subunit, meprin alpha, Mep-1a, Mep-1, Mep1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17287
HGNC: HGNC:7015
Homologene: 31323
Zmynd10
Name: zinc finger, MYND domain containing 10
Synonyms: Blu
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 114602
Homologene: 9293
Itgav
Name: integrin alpha V
Synonyms: vitronectin receptor alpha polypeptide (VNRA), CD51, alphav-integrin, 1110004F14Rik, 2610028E01Rik, D430040G12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16410
HGNC: HGNC:6150
Homologene: 20510
Oxa1l
Name: oxidase assembly 1-like
Synonyms: 1810020M02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 69089
HGNC: HGNC:8526
Homologene: 31281
Zfp536
Name: zinc finger protein 536
Synonyms: 9630010P11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243937
Homologene: 8813
Or7g33
Name: olfactory receptor family 7 subfamily G member 33
Synonyms: GA_x6K02T2PVTD-13277703-13276786, MOR154-1, Olfr853
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258908
Homologene: 133623
Chst8
Name: carbohydrate sulfotransferase 8
Synonyms: 1500011J21Rik, GalNAc4ST-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68947
Homologene: 41483
Matcap1
Name: microtubule associated tyrosine carboxypeptidase 1
Synonyms: MATCAP, 4931428F04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74356
Homologene: 47588
Dip2a
Name: disco interacting protein 2 homolog A
Synonyms: Kiaa0184-hp, 4931420H10Rik, Dip2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64451
Homologene: 41012
Immp1l
Name: IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae)
Synonyms: 2610528O17Rik, 1500034J20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66541
Homologene: 41747
Actrt2
Name: actin-related protein T2
Synonyms: Arp-T2, 1700052K15Rik, Arpm2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73353
Homologene: 23647
Map3k9
Name: mitogen-activated protein kinase kinase kinase 9
Synonyms: Mlk1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 338372
VEGA: 12
HGNC: HGNC:6861
Homologene: 76377
Ankrd55
Name: ankyrin repeat domain 55
Synonyms: C030011J08Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 77318
VEGA: 13
Homologene: 12674
Or4b13
Name: olfactory receptor family 4 subfamily B member 13
Synonyms: K20, MOR227-2, GA_x6K02T2Q125-51607674-51606757, Olfr142
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 406186
HGNC: HGNC:8290
Homologene: 45081
Txnrd2
Name: thioredoxin reductase 2
Synonyms: ESTM573010, TR beta, TR3, TGR
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 26462
Homologene: 4701
Gpr156
Name: G protein-coupled receptor 156
Synonyms: Gababl
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239845
VEGA: 16
Homologene: 17683
Rad18
Name: RAD18 E3 ubiquitin protein ligase
Synonyms: 2810024C04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 58186
Homologene: 48572
Sh3d21
Name: SH3 domain containing 21
Synonyms: 1700029G01Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66938
Homologene: 12057
Fcgr2b
Name: Fc receptor, IgG, low affinity IIb
Synonyms: CD32, FcgRII, Fc[g]RII, Fc gamma RIIB, FcgammaRIIB, Fcgr2, Fcr-2, Ly-m20, Ly-17, LyM-1, Fcr-3, Fcgr2a, F630109E10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14130
Homologene: 2974
Paqr9
Name: progestin and adipoQ receptor family member IX
Synonyms: 1700020G04Rik, C730029A08Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75552
Homologene: 18882
Vps45
Name: vacuolar protein sorting 45
Synonyms: mVps45
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22365
Homologene: 5250
Nudt18
Name: nudix hydrolase 18
Synonyms: nudix (nucleoside diphosphate linked moiety X)-type motif 18
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 213484
VEGA: 14
Homologene: 32604
Catsper2
Name: cation channel, sperm associated 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 212670
Homologene: 77423
Rps2
Name: ribosomal protein S2
Synonyms: Rps2, Llrep3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16898
Homologene: 37714
Igkv4-54
Name: immunoglobulin kappa chain variable 4-54
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 385291
Iglc3
Name: immunoglobulin lambda constant 3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 110787
HGNC: HGNC:5861
Potefam3f
Name: POTE ankyrin domain family member 3F
Synonyms: Pote3f, Gm31371
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 78672
Homologene: 128726
Or6c5b
Name: olfactory receptor family 6 subfamily C member 5B
Synonyms: GA_x6K02T2PULF-11089673-11090600, MOR111-8P, MOR111-14_i, EG546488, Olfr785-ps1, Gm44444, Olfr785
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 546488
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 72,452,478 bp
  • A to T, chromosome 1 at 119,690,034 bp
  • A to G, chromosome 1 at 155,910,753 bp
  • A to G, chromosome 1 at 170,965,700 bp
  • A to C, chromosome 1 at 181,112,286 bp
  • G to A, chromosome 2 at 41,269,212 bp
  • G to T, chromosome 2 at 52,258,741 bp
  • A to T, chromosome 2 at 83,724,835 bp
  • G to A, chromosome 2 at 90,252,821 bp
  • A to T, chromosome 2 at 103,779,474 bp
  • G to A, chromosome 2 at 105,937,056 bp
  • TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT to TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT, chromosome 2 at 121,397,572 bp
  • T to C, chromosome 2 at 161,533,523 bp
  • C to T, chromosome 2 at 164,825,799 bp
  • A to G, chromosome 3 at 30,140,356 bp
  • T to C, chromosome 3 at 96,041,405 bp
  • A to T, chromosome 4 at 25,254,637 bp
  • A to G, chromosome 4 at 59,690,502 bp
  • A to G, chromosome 4 at 70,337,429 bp
  • A to G, chromosome 4 at 126,152,115 bp
  • A to C, chromosome 4 at 154,667,423 bp
  • T to C, chromosome 5 at 108,703,499 bp
  • T to C, chromosome 5 at 120,585,250 bp
  • T to C, chromosome 6 at 47,533,774 bp
  • T to A, chromosome 6 at 69,631,858 bp
  • T to C, chromosome 6 at 90,384,173 bp
  • G to T, chromosome 6 at 112,665,325 bp
  • A to T, chromosome 7 at 31,303,596 bp
  • T to A, chromosome 7 at 34,675,936 bp
  • T to C, chromosome 7 at 37,569,206 bp
  • T to A, chromosome 7 at 102,421,532 bp
  • T to C, chromosome 7 at 102,742,344 bp
  • A to G, chromosome 8 at 19,903,421 bp
  • A to T, chromosome 8 at 105,284,699 bp
  • A to T, chromosome 9 at 19,537,333 bp
  • T to A, chromosome 9 at 39,144,857 bp
  • A to G, chromosome 9 at 86,792,616 bp
  • A to G, chromosome 9 at 95,560,193 bp
  • A to G, chromosome 9 at 107,548,777 bp
  • A to T, chromosome 9 at 111,367,512 bp
  • T to A, chromosome 10 at 18,625,391 bp
  • C to T, chromosome 10 at 76,272,532 bp
  • T to A, chromosome 10 at 121,869,790 bp
  • T to A, chromosome 10 at 128,042,598 bp
  • T to C, chromosome 10 at 129,410,182 bp
  • A to G, chromosome 11 at 9,290,732 bp
  • G to A, chromosome 11 at 34,714,513 bp
  • G to T, chromosome 11 at 59,103,318 bp
  • G to A, chromosome 11 at 115,801,896 bp
  • T to C, chromosome 12 at 81,725,830 bp
  • A to G, chromosome 13 at 25,102,391 bp
  • A to G, chromosome 13 at 112,336,253 bp
  • T to C, chromosome 14 at 16,416,962 bp
  • A to T, chromosome 14 at 54,360,855 bp
  • A to G, chromosome 14 at 70,577,982 bp
  • G to A, chromosome 15 at 16,778,255 bp
  • A to T, chromosome 15 at 63,833,334 bp
  • A to T, chromosome 15 at 76,177,343 bp
  • A to T, chromosome 16 at 14,127,093 bp
  • T to C, chromosome 16 at 17,139,691 bp
  • T to C, chromosome 16 at 18,456,072 bp
  • T to C, chromosome 16 at 19,065,441 bp
  • C to A, chromosome 16 at 37,947,741 bp
  • T to C, chromosome 16 at 87,409,387 bp
  • A to G, chromosome 16 at 96,820,808 bp
  • T to A, chromosome 17 at 24,720,580 bp
  • A to T, chromosome 17 at 34,572,517 bp
  • A to T, chromosome 17 at 43,475,104 bp
  • T to C, chromosome 18 at 4,334,036 bp
  • A to G, chromosome 18 at 60,943,205 bp
  • T to A, chromosome 19 at 6,077,389 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7247 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045310-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.