Strain Name:
C57BL/6J-MtgxR7249Btlr/Mmmh
Stock Number:
045312-MU
Citation ID:
RRID:MMRRC_045312-MU
Other Names:
R7249 (G1)
Major Collection:

Strain Information

Gabra6
Name: gamma-aminobutyric acid type A receptor subunit alpha 6
Synonyms: Gabra-6, alpha6, GABA-ARalpha6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14399
HGNC: HGNC:4080
Homologene: 20220
Htr5b
Name: 5-hydroxytryptamine (serotonin) receptor 5B
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15564
Homologene: 74951
D630045J12Rik
Name: RIKEN cDNA D630045J12 gene
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330286
Homologene: 19782
Mtmr7
Name: myotubularin related protein 7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54384
HGNC: HGNC:7454
Homologene: 99732
Jmjd1c
Name: jumonji domain containing 1C
Synonyms: TRIP8, 5430433L24Rik, D630035I23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 108829
Homologene: 3129
Spidr
Name: scaffolding protein involved in DNA repair
Synonyms: 2310008H04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224008
VEGA: 16
Homologene: 51693
Hspa12a
Name: heat shock protein 12A
Synonyms: Hspa12a, 1700063D12Rik, Gm19925
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73442
VEGA: 19
Homologene: 18422
Plcb4
Name: phospholipase C, beta 4
Synonyms: C230058B11Rik, A930039J07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18798
HGNC: HGNC:9059
Homologene: 8471
Pmpca
Name: peptidase (mitochondrial processing) alpha
Synonyms: INPP5E, Alpha-MPP, 4933435E07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66865
Homologene: 6078
Rbpms2
Name: RNA binding protein with multiple splicing 2
Synonyms: 2400008B06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71973
VEGA: 9
Homologene: 49895
Msra
Name: methionine sulfoxide reductase A
Synonyms: MSR-A, 2310045J23Rik, 6530413P12Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110265
HGNC: HGNC:7377
Homologene: 5812
Traf3ip1
Name: TRAF3 interacting protein 1
Synonyms: 3930402D05Rik, MIP-T3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74019
Homologene: 22913
Nup214
Name: nucleoporin 214
Synonyms: D2H9S46E, CAN
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227720
HGNC: HGNC:8064
Homologene: 38008
Abi1
Name: abl interactor 1
Synonyms: E3B1, Ssh3bp1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11308
Homologene: 38053
Trim23
Name: tripartite motif-containing 23
Synonyms: Arfd1, 6330516O20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 81003
HGNC: HGNC:660
Homologene: 1251
Tep1
Name: telomerase associated protein 1
Synonyms: Tp1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21745
VEGA: 14
Homologene: 5157
Tiam1
Name: T cell lymphoma invasion and metastasis 1
Synonyms: D16Ium10, D16Ium10e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 21844
Homologene: 2443
Ap3d1
Name: adaptor-related protein complex 3, delta 1 subunit
Synonyms: mBLVR1, Bolvr
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11776
VEGA: 10
HGNC: HGNC:568
Homologene: 2926
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Adra2c
Name: adrenergic receptor, alpha 2c
Synonyms: alpha2-C4, subtype alpha2-C4, [a]2C, alpha2C, Adra-2c
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11553
HGNC: HGNC:283
Homologene: 20170
Nmnat1
Name: nicotinamide nucleotide adenylyltransferase 1
Synonyms: 5730441G13Rik, D4Cole1e, 2610529L11Rik, nicotinamide mononucleotide adenylyl transferase, nmnat
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66454
Homologene: 39074
Mastl
Name: microtubule associated serine/threonine kinase-like
Synonyms: THC2, 2700091H24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67121
Homologene: 12086
Ntng2
Name: netrin G2
Synonyms: Lmnt2, 2610016D08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 171171
Homologene: 13053
Robo3
Name: roundabout guidance receptor 3
Synonyms: Rig-1, Rbig1, Robo3b, Robo3a, Rig1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19649
Homologene: 32119
Gfpt1
Name: glutamine fructose-6-phosphate transaminase 1
Synonyms: GFAT, GFA, GFAT1, 2810423A18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14583
HGNC: HGNC:4241
Homologene: 68220
Itgb1
Name: integrin beta 1 (fibronectin receptor beta)
Synonyms: CD29, beta1 integrin, 4633401G24Rik, Fnrb, Gm9863
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16412
HGNC: HGNC:6153
Homologene: 22999
Carm1
Name: coactivator-associated arginine methyltransferase 1
Synonyms: Prmt4, m9Bei
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 59035
Homologene: 10990
Svil
Name: supervillin
Synonyms: B430302E16Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225115
Homologene: 25090
Zdhhc24
Name: zinc finger, DHHC domain containing 24
Synonyms: 5730496N17Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 70605
Homologene: 41720
Irf8
Name: interferon regulatory factor 8
Synonyms: IRF-8, ICSBP, Myls, Icsbp1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 15900
HGNC: HGNC:5358
Homologene: 1629
Pnp
Name: purine-nucleoside phosphorylase
Synonyms: Np-2, Np-1, Np, Pnp, Pnp1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18950
HGNC: HGNC:7892
Homologene: 227
Tsc2
Name: TSC complex subunit 2
Synonyms: tuberin, Nafld, tuberous sclerosis 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22084
VEGA: 17
Homologene: 462
Itpr2
Name: inositol 1,4,5-triphosphate receptor 2
Synonyms: Ip3r2, Itpr5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16439
HGNC: HGNC:6181
Homologene: 37593
Cacna1d
Name: calcium channel, voltage-dependent, L type, alpha 1D subunit
Synonyms: D-LTCC, Cchl1a, Cchl1a2, Cacnl1a2, 8430418G19Rik, Cav1.3alpha1, C79217
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12289
VEGA: 14
HGNC: HGNC:1391
Homologene: 578
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Faap24
Name: Fanconi anemia core complex associated protein 24
Synonyms: C230052I12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101831
Homologene: 17535
Eln
Name: elastin
Synonyms: tropoelastin, E030024M20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13717
HGNC: HGNC:3327
Tie1
Name: tyrosine kinase with immunoglobulin-like and EGF-like domains 1
Synonyms: TIE, D430008P04Rik, tie-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21846
Homologene: 3957
Pitrm1
Name: pitrilysin metallepetidase 1
Synonyms: 2310012C15Rik, MP-1, Ntup1, PreP
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69617
VEGA: 13
Homologene: 5742
Shank1
Name: SH3 and multiple ankyrin repeat domains 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243961
Homologene: 22949
Arfgef3
Name: ARFGEF family member 3
Synonyms: B930094H20Rik, D10Bwg1379e, BIG3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215821
VEGA: 10
Homologene: 41366
Actl6b
Name: actin-like 6B
Synonyms: Baf53b, ArpNa, Actl6
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 83766
HGNC: HGNC:160
Homologene: 81844
Phldb2
Name: pleckstrin homology like domain, family B, member 2
Synonyms: C820004H04Rik, LL5beta, LL5b
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208177
Homologene: 17100
Xkr4
Name: X-linked Kx blood group related 4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 497097
Homologene: 45848
3425401B19Rik
Name: RIKEN cDNA 3425401B19 gene
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100504518
VEGA: 14
Homologene: 54908
Clip1
Name: CAP-GLY domain containing linker protein 1
Synonyms: cytoplasmic linker protein 50, Clip50, CLIP-170, 1110007I12Rik, 4631429H07Rik, Rsn, Clip 170, restin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56430
Homologene: 74455
Or4a2
Name: olfactory receptor family 4 subfamily A member 2
Synonyms: GA_x6K02T2Q125-50861284-50860367, MOR231-3, Olfr1239
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258972
Homologene: 74244
Pkn3
Name: protein kinase N3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 263803
Homologene: 50980
H2-T10
Name: histocompatibility 2, T region locus 10
Synonyms: H-2T10
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15024
1700011L22Rik
Name: RIKEN cDNA 1700011L22 gene
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67687
Homologene: 78034
Ssx2ip
Name: SSX family member 2 interacting protein
Synonyms: Adip
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99167
Homologene: 8522
Cyp27b1
Name: cytochrome P450, family 27, subfamily b, polypeptide 1
Synonyms: 1alpha(OH)ase, P450VD1alpha, 25-hydroxyvitamin D3 1alpha-hydroxylase, 25(OH)D 1alpha-hydroxylase, VddrI, P450c1, Cyp27b, Vddr, Vdd1, Pddr, Cyp1, Cp2b, Cyp40
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13115
HGNC: HGNC:2606
Homologene: 37139
Dpp4
Name: dipeptidylpeptidase 4
Synonyms: THAM, Dpp-4, Cd26
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13482
HGNC: HGNC:3009
Homologene: 3279
Mis18a
Name: MIS18 kinetochore protein A
Synonyms: 2810018N07Rik, 2610039C10Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66578
HGNC: HGNC:1286
Homologene: 41294
Nelfcd
Name: negative elongation factor complex member C/D, Th1l
Synonyms: 2410003I03Rik, trihydrophobin 1, Th1l
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 57314
Homologene: 9496
Lrrc8b
Name: leucine rich repeat containing 8 family, member B
Synonyms: R75581, 2210408K08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 433926
Homologene: 9103
Pskh1
Name: protein serine kinase H1
Synonyms: E130013P03Rik, b2b1230Clo
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244631
HGNC: HGNC:9529
Homologene: 48461
Nemp1
Name: nuclear envelope integral membrane protein 1
Synonyms: Tmem194
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 210035
Homologene: 18346
Marchf8
Name: membrane associated ring-CH-type finger 8
Synonyms: 1300017E09Rik, Mir, March8
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71779
Homologene: 12412
Septin8
Name: septin 8
Synonyms: Sepl, Sept8
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20362
Homologene: 57205
Slco4a1
Name: solute carrier organic anion transporter family, member 4a1
Synonyms: OATP-E, Slc21a12
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 108115
Homologene: 9482
Malrd1
Name: MAM and LDL receptor class A domain containing 1
Synonyms: Gm13318, Gm13364, Diet1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 102635496
Homologene: 136214
Vmn1r157
Name: vomeronasal 1 receptor 157
Synonyms: Gm4517, Gm8699, Vmn1r109
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 667551
Homologene: 104166
Dchs2
Name: dachsous cadherin related 2
Synonyms: LOC229459
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100534287
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 3,216,810 bp
  • G to T, chromosome 1 at 91,527,639 bp
  • T to A, chromosome 1 at 121,510,474 bp
  • G to T, chromosome 2 at 15,623,340 bp
  • T to C, chromosome 2 at 22,957,089 bp
  • G to A, chromosome 2 at 23,146,139 bp
  • G to C, chromosome 2 at 26,395,034 bp
  • A to G, chromosome 2 at 29,227,992 bp
  • G to A, chromosome 2 at 30,084,761 bp
  • A to G, chromosome 2 at 31,988,233 bp
  • A to G, chromosome 2 at 62,385,203 bp
  • T to C, chromosome 2 at 89,417,873 bp
  • A to G, chromosome 2 at 136,007,821 bp
  • T to C, chromosome 2 at 174,423,206 bp
  • A to G, chromosome 2 at 180,464,811 bp
  • C to T, chromosome 3 at 83,128,029 bp
  • A to G, chromosome 3 at 146,426,438 bp
  • A to G, chromosome 4 at 118,486,228 bp
  • G to A, chromosome 4 at 149,469,642 bp
  • G to A, chromosome 5 at 35,280,955 bp
  • G to T, chromosome 5 at 105,481,267 bp
  • T to C, chromosome 5 at 123,603,600 bp
  • AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC to AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC, chromosome 5 at 134,711,081 bp
  • T to A, chromosome 5 at 137,555,085 bp
  • A to T, chromosome 6 at 38,136,950 bp
  • A to G, chromosome 6 at 87,056,144 bp
  • G to A, chromosome 6 at 116,406,234 bp
  • C to A, chromosome 6 at 146,311,052 bp
  • T to C, chromosome 7 at 22,761,700 bp
  • A to G, chromosome 7 at 35,395,060 bp
  • C to T, chromosome 7 at 44,327,161 bp
  • A to G, chromosome 8 at 40,590,477 bp
  • T to C, chromosome 8 at 79,248,341 bp
  • T to C, chromosome 8 at 105,913,254 bp
  • C to A, chromosome 8 at 120,739,832 bp
  • C to A, chromosome 8 at 128,720,404 bp
  • T to C, chromosome 9 at 21,586,209 bp
  • T to A, chromosome 9 at 37,424,833 bp
  • T to G, chromosome 9 at 65,649,350 bp
  • A to T, chromosome 10 at 18,630,835 bp
  • T to A, chromosome 10 at 67,189,817 bp
  • T to C, chromosome 10 at 80,741,933 bp
  • G to T, chromosome 10 at 127,051,049 bp
  • T to C, chromosome 10 at 127,693,526 bp
  • A to T, chromosome 11 at 42,317,432 bp
  • A to T, chromosome 11 at 53,535,122 bp
  • C to T, chromosome 13 at 6,560,125 bp
  • G to A, chromosome 13 at 81,374,259 bp
  • A to G, chromosome 13 at 104,188,155 bp
  • T to C, chromosome 14 at 30,142,703 bp
  • G to T, chromosome 14 at 32,663,314 bp
  • A to T, chromosome 14 at 50,824,275 bp
  • G to A, chromosome 14 at 50,951,430 bp
  • A to G, chromosome 14 at 64,440,763 bp
  • T to C, chromosome 16 at 15,966,648 bp
  • C to A, chromosome 16 at 45,801,614 bp
  • T to C, chromosome 16 at 89,843,255 bp
  • T to C, chromosome 16 at 90,726,314 bp
  • AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG, chromosome 16 at 91,660,334 bp
  • A to G, chromosome 17 at 24,607,755 bp
  • T to C, chromosome 17 at 36,119,377 bp
  • T to C, chromosome 18 at 5,056,270 bp
  • T to C, chromosome 18 at 5,062,247 bp
  • T to G, chromosome 19 at 4,878,861 bp
  • T to A, chromosome 19 at 58,805,433 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7249 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045312-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.