Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7249Btlr/Mmmh
Stock Number:
045312-MU
Citation ID:
RRID:MMRRC_045312-MU
Other Names:
R7249 (G1)
Major Collection:

Strain Information

Gabra6
Name: gamma-aminobutyric acid type A receptor subunit alpha 6
Synonyms: Gabra-6, alpha6, GABA-ARalpha6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14399
HGNC: HGNC:4080
Homologene: 20220
Htr5b
Name: 5-hydroxytryptamine (serotonin) receptor 5B
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15564
Homologene: 74951
D630045J12Rik
Name: RIKEN cDNA D630045J12 gene
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330286
Homologene: 19782
Mtmr7
Name: myotubularin related protein 7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54384
HGNC: HGNC:7454
Homologene: 99732
Jmjd1c
Name: jumonji domain containing 1C
Synonyms: TRIP8, 5430433L24Rik, D630035I23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 108829
Homologene: 3129
Spidr
Name: scaffolding protein involved in DNA repair
Synonyms: 2310008H04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224008
VEGA: 16
Homologene: 51693
Hspa12a
Name: heat shock protein 12A
Synonyms: Hspa12a, 1700063D12Rik, Gm19925
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73442
VEGA: 19
Homologene: 18422
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 3,216,810 bp
  • G to T, chromosome 1 at 91,527,639 bp
  • T to A, chromosome 1 at 121,510,474 bp
  • G to T, chromosome 2 at 15,623,340 bp
  • T to C, chromosome 2 at 22,957,089 bp
  • G to A, chromosome 2 at 23,146,139 bp
  • G to C, chromosome 2 at 26,395,034 bp
  • A to G, chromosome 2 at 29,227,992 bp
  • G to A, chromosome 2 at 30,084,761 bp
  • A to G, chromosome 2 at 31,988,233 bp
  • A to G, chromosome 2 at 62,385,203 bp
  • T to C, chromosome 2 at 89,417,873 bp
  • A to G, chromosome 2 at 136,007,821 bp
  • T to C, chromosome 2 at 174,423,206 bp
  • A to G, chromosome 2 at 180,464,811 bp
  • C to T, chromosome 3 at 83,128,029 bp
  • A to G, chromosome 3 at 146,426,438 bp
  • A to G, chromosome 4 at 118,486,228 bp
  • G to A, chromosome 4 at 149,469,642 bp
  • G to A, chromosome 5 at 35,280,955 bp
  • G to T, chromosome 5 at 105,481,267 bp
  • T to C, chromosome 5 at 123,603,600 bp
  • AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC to AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC, chromosome 5 at 134,711,081 bp
  • T to A, chromosome 5 at 137,555,085 bp
  • A to T, chromosome 6 at 38,136,950 bp
  • A to G, chromosome 6 at 87,056,144 bp
  • G to A, chromosome 6 at 116,406,234 bp
  • C to A, chromosome 6 at 146,311,052 bp
  • T to C, chromosome 7 at 22,761,700 bp
  • A to G, chromosome 7 at 35,395,060 bp
  • C to T, chromosome 7 at 44,327,161 bp
  • A to G, chromosome 8 at 40,590,477 bp
  • T to C, chromosome 8 at 79,248,341 bp
  • T to C, chromosome 8 at 105,913,254 bp
  • C to A, chromosome 8 at 120,739,832 bp
  • C to A, chromosome 8 at 128,720,404 bp
  • T to C, chromosome 9 at 21,586,209 bp
  • T to A, chromosome 9 at 37,424,833 bp
  • T to G, chromosome 9 at 65,649,350 bp
  • A to T, chromosome 10 at 18,630,835 bp
  • T to A, chromosome 10 at 67,189,817 bp
  • T to C, chromosome 10 at 80,741,933 bp
  • G to T, chromosome 10 at 127,051,049 bp
  • T to C, chromosome 10 at 127,693,526 bp
  • A to T, chromosome 11 at 42,317,432 bp
  • A to T, chromosome 11 at 53,535,122 bp
  • C to T, chromosome 13 at 6,560,125 bp
  • G to A, chromosome 13 at 81,374,259 bp
  • A to G, chromosome 13 at 104,188,155 bp
  • T to C, chromosome 14 at 30,142,703 bp
  • G to T, chromosome 14 at 32,663,314 bp
  • A to T, chromosome 14 at 50,824,275 bp
  • G to A, chromosome 14 at 50,951,430 bp
  • A to G, chromosome 14 at 64,440,763 bp
  • T to C, chromosome 16 at 15,966,648 bp
  • C to A, chromosome 16 at 45,801,614 bp
  • T to C, chromosome 16 at 89,843,255 bp
  • T to C, chromosome 16 at 90,726,314 bp
  • AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG, chromosome 16 at 91,660,334 bp
  • A to G, chromosome 17 at 24,607,755 bp
  • T to C, chromosome 17 at 36,119,377 bp
  • T to C, chromosome 18 at 5,056,270 bp
  • T to C, chromosome 18 at 5,062,247 bp
  • T to G, chromosome 19 at 4,878,861 bp
  • T to A, chromosome 19 at 58,805,433 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7249 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045312-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.