Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7256Btlr/Mmmh
Stock Number:
045317-MU
Citation ID:
RRID:MMRRC_045317-MU
Other Names:
R7256 (G1)
Major Collection:

Strain Information

Cd86
Name: CD86 antigen
Synonyms: B7-2, MB7-2, B70, Ly-58, Cd28l2, B7.2, Ly58
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12524
HGNC: HGNC:1705
Homologene: 10443
Igll1
Name: immunoglobulin lambda-like polypeptide 1
Synonyms: Igll, Lambda 5, Igl-5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16136
Homologene: 131669
Etv4
Name: ets variant 4
Synonyms: Pea-3, Pea3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18612
HGNC: HGNC:3493
Homologene: 1504
Myh10
Name: myosin, heavy polypeptide 10, non-muscle
Synonyms: nonmuscle myosin heavy chain II-B, NMHC-B, SMemb, nonmuscle myosin heavy chain IIB, 9330167F11Rik, 5730504C04Rik, NMHC II-B, Myhn2, Myosin IIB, Myhn-2, myosin IIB, Fltn, Fltn
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77579
HGNC: HGNC:7568
Homologene: 55941
Cep290
Name: centrosomal protein 290
Synonyms: Nphp6, b2b1454Clo, b2b1752Clo, Kiaa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216274
VEGA: 10
Homologene: 77213
Papola
Name: poly (A) polymerase alpha
Synonyms: Plap, PapIII
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18789
Homologene: 23389
Fry
Name: FRY microtubule binding protein
Synonyms: cg003, 9330186A19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320365
Homologene: 113770
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 54,493,207 bp
  • A to G, chromosome 1 at 55,698,218 bp
  • A to C, chromosome 1 at 69,578,053 bp
  • A to T, chromosome 2 at 27,218,812 bp
  • T to C, chromosome 2 at 57,112,369 bp
  • A to G, chromosome 2 at 86,890,612 bp
  • A to T, chromosome 2 at 89,362,494 bp
  • T to A, chromosome 2 at 90,723,355 bp
  • T to C, chromosome 2 at 101,642,070 bp
  • G to A, chromosome 2 at 112,672,246 bp
  • G to T, chromosome 2 at 173,118,475 bp
  • T to C, chromosome 3 at 26,667,867 bp
  • A to T, chromosome 3 at 75,039,898 bp
  • T to A, chromosome 3 at 83,837,606 bp
  • C to T, chromosome 3 at 86,793,259 bp
  • T to C, chromosome 3 at 94,176,360 bp
  • T to A, chromosome 3 at 145,090,847 bp
  • C to T, chromosome 4 at 117,252,040 bp
  • T to A, chromosome 4 at 143,726,279 bp
  • T to C, chromosome 5 at 21,978,923 bp
  • A to G, chromosome 5 at 25,195,300 bp
  • A to G, chromosome 5 at 88,614,947 bp
  • G to T, chromosome 5 at 113,738,819 bp
  • T to G, chromosome 5 at 150,466,786 bp
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp
  • A to G, chromosome 6 at 60,976,114 bp
  • A to G, chromosome 6 at 61,311,867 bp
  • T to C, chromosome 6 at 120,762,529 bp
  • G to A, chromosome 6 at 142,770,586 bp
  • A to G, chromosome 7 at 5,060,326 bp
  • T to C, chromosome 7 at 19,484,703 bp
  • T to A, chromosome 7 at 20,787,445 bp
  • T to C, chromosome 7 at 45,341,743 bp
  • G to T, chromosome 7 at 86,615,665 bp
  • A to T, chromosome 8 at 34,090,808 bp
  • G to A, chromosome 8 at 93,499,526 bp
  • T to A, chromosome 9 at 21,745,744 bp
  • A to T, chromosome 9 at 36,120,989 bp
  • T to A, chromosome 9 at 38,268,708 bp
  • G to T, chromosome 10 at 14,129,101 bp
  • G to A, chromosome 10 at 41,556,001 bp
  • A to C, chromosome 10 at 43,493,671 bp
  • A to G, chromosome 10 at 52,400,993 bp
  • A to C, chromosome 10 at 53,296,255 bp
  • G to A, chromosome 10 at 80,853,731 bp
  • A to G, chromosome 10 at 100,546,498 bp
  • G to A, chromosome 10 at 121,288,965 bp
  • A to C, chromosome 11 at 68,790,689 bp
  • T to C, chromosome 11 at 69,431,094 bp
  • C to A, chromosome 11 at 96,319,896 bp
  • T to A, chromosome 11 at 101,784,325 bp
  • G to T, chromosome 11 at 120,428,550 bp
  • A to G, chromosome 12 at 50,388,342 bp
  • T to A, chromosome 12 at 105,809,345 bp
  • A to G, chromosome 13 at 6,556,597 bp
  • A to C, chromosome 13 at 23,249,866 bp
  • G to A, chromosome 13 at 91,884,518 bp
  • A to T, chromosome 13 at 100,479,201 bp
  • A to T, chromosome 14 at 33,962,583 bp
  • T to A, chromosome 14 at 54,857,420 bp
  • T to C, chromosome 14 at 118,885,646 bp
  • A to G, chromosome 16 at 16,861,093 bp
  • T to A, chromosome 16 at 21,892,238 bp
  • CA to CAA, chromosome 16 at 36,606,555 bp
  • A to G, chromosome 16 at 85,863,035 bp
  • A to G, chromosome 17 at 7,946,170 bp
  • T to C, chromosome 17 at 33,934,990 bp
  • A to G, chromosome 18 at 6,225,340 bp
  • G to A, chromosome 18 at 20,591,931 bp
  • C to A, chromosome 18 at 21,148,754 bp
  • A to T, chromosome 19 at 6,385,896 bp
  • A to T, chromosome 19 at 38,812,356 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7256 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045317-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.