Strain Name:
C57BL/6J-MtgxR7256Btlr/Mmmh
Stock Number:
045317-MU
Citation ID:
RRID:MMRRC_045317-MU
Other Names:
R7256 (G1)
Major Collection:

Strain Information

Cd86
Name: CD86 antigen
Synonyms: MB7-2, Ly58, Cd28l2, B70, B7.2, B7-2, Ly-58
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12524
HGNC: HGNC:1705
Homologene: 10443
Igll1
Name: immunoglobulin lambda-like polypeptide 1
Synonyms: Lambda 5, Igl-5, Igll
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16136
Homologene: 131669
Etv4
Name: ets variant 4
Synonyms: Pea-3, Pea3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18612
HGNC: HGNC:3493
Homologene: 1504
Myh10
Name: myosin, heavy polypeptide 10, non-muscle
Synonyms: nonmuscle myosin heavy chain IIB, SMemb, NMHC-B, nonmuscle myosin heavy chain II-B, Myhn-2, 5730504C04Rik, myosin IIB, Fltn, Myhn2, Fltn, NMHC II-B, Myosin IIB, 9330167F11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77579
HGNC: HGNC:7568
Homologene: 55941
Cep290
Name: centrosomal protein 290
Synonyms: Kiaa, b2b1454Clo, b2b1752Clo, Nphp6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216274
VEGA: 10
Homologene: 77213
Papola
Name: poly (A) polymerase alpha
Synonyms: Plap, PapIII
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18789
Homologene: 23389
Fry
Name: FRY microtubule binding protein
Synonyms: 9330186A19Rik, cg003
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320365
Homologene: 113770
Kif5b
Name: kinesin family member 5B
Synonyms: Khc, kinesin heavy chain
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16573
HGNC: HGNC:6324
Homologene: 55829
Rufy3
Name: RUN and FYVE domain containing 3
Synonyms: 2810428M05Rik, Rpipx, D5Bwg0860e, 6330416M07Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52822
Homologene: 87809
Nploc4
Name: NPL4 homolog, ubiquitin recognition factor
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217365
Homologene: 5403
Bend3
Name: BEN domain containing 3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 331623
VEGA: 10
Homologene: 19511
Tlr2
Name: toll-like receptor 2
Synonyms: Ly105
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 24088
Homologene: 20695
Dclk2
Name: doublecortin-like kinase 2
Synonyms: 6330415M09Rik, Click-II, Dcamkl2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70762
Homologene: 69431
Cmas
Name: cytidine monophospho-N-acetylneuraminic acid synthetase
Synonyms: CMP-sialic acid synthetase, D6Bwg0250e, CMP-Neu5Ac synthase
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12764
Homologene: 7670
Garem1
Name: GRB2 associated regulator of MAPK1 subtype 1
Synonyms: LOC381126, Fam59a, Garem
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 381126
VEGA: 18
Homologene: 11237
Rag1
Name: recombination activating 1
Synonyms: Rag-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19373
HGNC: HGNC:9831
Homologene: 387
Ldlr
Name: low density lipoprotein receptor
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 16835
VEGA: 9
HGNC: HGNC:6547
Homologene: 55469
Clca2
Name: chloride channel accessory 2
Synonyms: Clca5
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229933
HGNC: HGNC:2016
Homologene: 4765
Cecr2
Name: CECR2, histone acetyl-lysine reader
Synonyms: 2610101O16Rik, 2810409N01Rik, cat eye syndrome chromosome region, candidate 2, Gtl4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330409
HGNC: HGNC:1840
Homologene: 64662
Dsg2
Name: desmoglein 2
Synonyms: D18Ertd293e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13511
HGNC: HGNC:3049
Homologene: 1464
Nup160
Name: nucleoporin 160
Synonyms: 2810011M03Rik, Gtl1-13
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 59015
Homologene: 32509
Noc3l
Name: NOC3 like DNA replication regulator
Synonyms: Fad24
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 57753
VEGA: 19
Homologene: 39642
Pgap1
Name: post-GPI attachment to proteins 1
Synonyms: PGAP1, 5033403E17Rik, D230012E17Rik, 9030223K07Rik, oto
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241062
Homologene: 41605
Rbp3
Name: retinol binding protein 3, interstitial
Synonyms: Rbp-3, Irbp
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19661
VEGA: 14
HGNC: HGNC:9921
Homologene: 9261
Nr4a2
Name: nuclear receptor subfamily 4, group A, member 2
Synonyms: RNR-1, Nurr1, HZF-3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18227
HGNC: HGNC:7981
Homologene: 4509
Peg10
Name: paternally expressed 10
Synonyms: HB-1, Edr, MyEF-3 like, MEF3L, Mart2, Rtl2, MyEF-3, Mar2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Reln
Name: reelin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19699
HGNC: HGNC:9957
Homologene: 3699
Dnah2
Name: dynein, axonemal, heavy chain 2
Synonyms: Dnahc2, D330014H01Rik, Dnhd3, 2900022L05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327954
HGNC: HGNC:2948
Homologene: 72110
Hivep2
Name: human immunodeficiency virus type I enhancer binding protein 2
Synonyms: Schnurri-2, MIBP1, Gm20114, Shn-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15273
HGNC: HGNC:4921
Homologene: 4900
Ccser1
Name: coiled-coil serine rich 1
Synonyms: Fam190a, C130092O11Rik, 6230405M12Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232035
Homologene: 28086
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Or8h7
Name: olfactory receptor family 8 subfamily H member 7
Synonyms: GA_x6K02T2Q125-48376288-48375341, Olfr1097, MOR206-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258840
Homologene: 37005
Plcl1
Name: phospholipase C-like 1
Synonyms: C230017K02Rik, PLC-L, PRIP-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227120
HGNC: HGNC:9063
Homologene: 38155
Galntl5
Name: UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5
Synonyms: 1700021B12Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67909
Homologene: 12210
Pitrm1
Name: pitrilysin metallepetidase 1
Synonyms: MP-1, 2310012C15Rik, PreP, Ntup1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69617
VEGA: 13
Homologene: 5742
Spata16
Name: spermatogenesis associated 16
Synonyms: Nyd-sp12, spermatogenesis-related protein, 4930503K02Rik, 4921511F01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70862
Homologene: 49974
Map3k13
Name: mitogen-activated protein kinase kinase kinase 13
Synonyms: C130026N12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 71751
VEGA: 16
HGNC: HGNC:6852
Homologene: 37958
Ccdc106
Name: coiled-coil domain containing 106
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232821
Homologene: 81845
Nepn
Name: nephrocan
Synonyms: periolin, Npn, 5730521E12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66650
Homologene: 23549
Cep85l
Name: centrosomal protein 85-like
Synonyms: Gm9766
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100038725
VEGA: 10
Homologene: 52598
Ces5a
Name: carboxylesterase 5A
Synonyms: cauxin, LOC244598, 1700122C07Rik, Ces7, 1700081L16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67935
Homologene: 74305
Ficd
Name: FIC domain containing
Synonyms: D5Ertd40e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231630
Homologene: 5139
Mmrn1
Name: multimerin 1
Synonyms: Emilin4, 4921530G03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70945
HGNC: HGNC:7178
Homologene: 49134
Ctcfl
Name: CCCTC-binding factor like
Synonyms: OTTMUSG00000016680, Boris
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 664799
Homologene: 46476
Zbbx
Name: zinc finger, B-box domain containing
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213234
Homologene: 11661
Ppfia3
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3
Synonyms: 2410127E16Rik, Liprin-alpha3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76787
HGNC: HGNC:9247
Homologene: 37833
Sardh
Name: sarcosine dehydrogenase
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 192166
Homologene: 5149
Vmn1r113
Name: vomeronasal 1 receptor 113
Synonyms: Gm5748
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 436135
Homologene: 104166
Dzip1
Name: DAZ interacting protein 1
Synonyms: 2810422M04Rik, 2510025K24Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66573
VEGA: 14
Homologene: 45708
Pygm
Name: muscle glycogen phosphorylase
Synonyms: PG
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19309
HGNC: HGNC:9726
Homologene: 2145
Rgl2
Name: ral guanine nucleotide dissociation stimulator-like 2
Synonyms: Rlf, KE1.5, Rgt2, Rab2l
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19732
HGNC: HGNC:9769
Homologene: 3494
Prkd1
Name: protein kinase D1
Synonyms: Pkcm, Prkcm, PKD1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18760
VEGA: 12
HGNC: HGNC:9407
Homologene: 55680
Adamts5
Name: ADAM metallopeptidase with thrombospondin type 1 motif 5
Synonyms: 9530092O11Rik, ADAM-TS5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 23794
VEGA: 16
HGNC: HGNC:221
Homologene: 5109
Ccdc162
Name: coiled-coil domain containing 162
Synonyms: 5033413D22Rik, Gm29096, Gm6976
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75973
Homologene: 136355
Rsph3a
Name: radial spoke 3A homolog (Chlamydomonas)
Synonyms: Rshl2a, Rshl2, 1700012G05Rik, 4930524H12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66832
VEGA: 17
Homologene: 12043
Hoxb4
Name: homeobox B4
Synonyms: Hox-2.6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15412
HGNC: HGNC:5115
Homologene: 32095
Gtf2h2
Name: general transcription factor II H, polypeptide 2
Synonyms: p44, basal transcription factor 2, p44 subunit, 44kDa, Btf2p44
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 23894
Homologene: 1159
Or8c17
Name: olfactory receptor family 8 subfamily C member 17
Synonyms: MOR170-1, Olfr895, GA_x6K02T2PVTD-31962461-31963411
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258875
Homologene: 74253
Rasgrf2
Name: RAS protein-specific guanine nucleotide-releasing factor 2
Synonyms: 6330417G04Rik, Grf2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19418
HGNC: HGNC:9876
Homologene: 2169
Or14a256
Name: olfactory receptor family 14 subfamily A member 256
Synonyms: GA_x6K02T2NHDJ-9504525-9505532, MOR219-5, Olfr294
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 257904
Or4a15
Name: olfactory receptor family 4 subfamily A member 15
Synonyms: GA_x6K02T2Q125-50805620-50804676, Olfr1234, MOR231-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258975
Homologene: 128156
Ikzf2
Name: IKAROS family zinc finger 2
Synonyms: Helios, Zfpn1a2, A730095J18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22779
Homologene: 22659
Exoc3l2
Name: exocyst complex component 3-like 2
Synonyms: Gm19857, 4933417E01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74463
Homologene: 16328
Vmn1r223
Name: vomeronasal 1 receptor 223
Synonyms: Gm11330
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 100036518
Homologene: 110880
Tmem53
Name: transmembrane protein 53
Synonyms: 1110038M16Rik, 1700012A05Rik, 1500001P22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68777
Homologene: 41573
Homez
Name: homeodomain leucine zipper-encoding gene
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239099
Homologene: 10828
Dctn6
Name: dynactin 6
Synonyms: p27, WS-3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22428
Homologene: 4792
Tbc1d30
Name: TBC1 domain family, member 30
Synonyms: 4930505D03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74694
VEGA: 10
Homologene: 18930
Spopfm2
Name: speckle-type BTB/POZ protein family member 2
Synonyms: Gm10696
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100043188
Homologene: 128308
Gm5916
Name: predicted gene 5916
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546123
Lsm7
Name: LSM7 homolog, U6 small nuclear RNA and mRNA degradation associated
Synonyms: 0910001B06Rik, 1110033F18Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66094
VEGA: 10
Homologene: 6781
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 54,493,207 bp
  • A to G, chromosome 1 at 55,698,218 bp
  • A to C, chromosome 1 at 69,578,053 bp
  • A to T, chromosome 2 at 27,218,812 bp
  • T to C, chromosome 2 at 57,112,369 bp
  • A to G, chromosome 2 at 86,890,612 bp
  • A to T, chromosome 2 at 89,362,494 bp
  • T to A, chromosome 2 at 90,723,355 bp
  • T to C, chromosome 2 at 101,642,070 bp
  • G to A, chromosome 2 at 112,672,246 bp
  • G to T, chromosome 2 at 173,118,475 bp
  • T to C, chromosome 3 at 26,667,867 bp
  • A to T, chromosome 3 at 75,039,898 bp
  • T to A, chromosome 3 at 83,837,606 bp
  • C to T, chromosome 3 at 86,793,259 bp
  • T to C, chromosome 3 at 94,176,360 bp
  • T to A, chromosome 3 at 145,090,847 bp
  • C to T, chromosome 4 at 117,252,040 bp
  • T to A, chromosome 4 at 143,726,279 bp
  • T to C, chromosome 5 at 21,978,923 bp
  • A to G, chromosome 5 at 25,195,300 bp
  • A to G, chromosome 5 at 88,614,947 bp
  • G to T, chromosome 5 at 113,738,819 bp
  • T to G, chromosome 5 at 150,466,786 bp
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp
  • A to G, chromosome 6 at 60,976,114 bp
  • A to G, chromosome 6 at 61,311,867 bp
  • T to C, chromosome 6 at 120,762,529 bp
  • G to A, chromosome 6 at 142,770,586 bp
  • A to G, chromosome 7 at 5,060,326 bp
  • T to C, chromosome 7 at 19,484,703 bp
  • T to A, chromosome 7 at 20,787,445 bp
  • T to C, chromosome 7 at 45,341,743 bp
  • G to T, chromosome 7 at 86,615,665 bp
  • A to T, chromosome 8 at 34,090,808 bp
  • G to A, chromosome 8 at 93,499,526 bp
  • T to A, chromosome 9 at 21,745,744 bp
  • A to T, chromosome 9 at 36,120,989 bp
  • T to A, chromosome 9 at 38,268,708 bp
  • G to T, chromosome 10 at 14,129,101 bp
  • G to A, chromosome 10 at 41,556,001 bp
  • A to C, chromosome 10 at 43,493,671 bp
  • A to G, chromosome 10 at 52,400,993 bp
  • A to C, chromosome 10 at 53,296,255 bp
  • G to A, chromosome 10 at 80,853,731 bp
  • A to G, chromosome 10 at 100,546,498 bp
  • G to A, chromosome 10 at 121,288,965 bp
  • A to C, chromosome 11 at 68,790,689 bp
  • T to C, chromosome 11 at 69,431,094 bp
  • C to A, chromosome 11 at 96,319,896 bp
  • T to A, chromosome 11 at 101,784,325 bp
  • G to T, chromosome 11 at 120,428,550 bp
  • A to G, chromosome 12 at 50,388,342 bp
  • T to A, chromosome 12 at 105,809,345 bp
  • A to G, chromosome 13 at 6,556,597 bp
  • A to C, chromosome 13 at 23,249,866 bp
  • G to A, chromosome 13 at 91,884,518 bp
  • A to T, chromosome 13 at 100,479,201 bp
  • A to T, chromosome 14 at 33,962,583 bp
  • T to A, chromosome 14 at 54,857,420 bp
  • T to C, chromosome 14 at 118,885,646 bp
  • A to G, chromosome 16 at 16,861,093 bp
  • T to A, chromosome 16 at 21,892,238 bp
  • CA to CAA, chromosome 16 at 36,606,555 bp
  • A to G, chromosome 16 at 85,863,035 bp
  • A to G, chromosome 17 at 7,946,170 bp
  • T to C, chromosome 17 at 33,934,990 bp
  • A to G, chromosome 18 at 6,225,340 bp
  • G to A, chromosome 18 at 20,591,931 bp
  • C to A, chromosome 18 at 21,148,754 bp
  • A to T, chromosome 19 at 6,385,896 bp
  • A to T, chromosome 19 at 38,812,356 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7256 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045317-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.