Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7193Btlr/Mmmh
Stock Number:
045334-MU
Citation ID:
RRID:MMRRC_045334-MU
Other Names:
R7193 (G1)
Major Collection:

Strain Information

Cacna1g
Name: calcium channel, voltage-dependent, T type, alpha 1G subunit
Synonyms: a1G, Cav3.1d
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12291
HGNC: HGNC:1394
Homologene: 22544
Ncam2
Name: neural cell adhesion molecule 2
Synonyms: RNCAM, R4B12 antigen, Ncam-2, Ocam
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17968
HGNC: HGNC:7657
Homologene: 3336
Crybg3
Name: beta-gamma crystallin domain containing 3
Synonyms: Gm9581
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224273
Homologene: 28544
Pias2
Name: protein inhibitor of activated STAT 2
Synonyms: Dib, 6330408K17Rik, ARIP3, PIASxbeta, PIASxalpha, PIASxb, Miz1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17344
VEGA: 18
Homologene: 20979
Zbtb7c
Name: zinc finger and BTB domain containing 7C
Synonyms: B230208J24Rik, Zbtb36, Kr-pok
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 207259
VEGA: 18
Homologene: 17070
Rgs3
Name: regulator of G-protein signaling 3
Synonyms: 4930506N09Rik, C2pa, PDZ-RGS3, RGS3S, C2PA-RGS3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 50780
HGNC: HGNC:9999
Homologene: 32440
Cdyl2
Name: chromodomain protein, Y chromosome-like 2
Synonyms: 1700029M19Rik, 4930453I21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 75796
Homologene: 41779
Igf1r
Name: insulin-like growth factor I receptor
Synonyms: CD221, IGF-1R, line 186, hyft, A330103N21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16001
HGNC: HGNC:5465
Homologene: 30997
Prep
Name: prolyl endopeptidase
Synonyms: prolyl oligopeptidase, D10Wsu136e, Pop
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19072
VEGA: 10
HGNC: HGNC:9358
Homologene: 2042
Prdm2
Name: PR domain containing 2, with ZNF domain
Synonyms: Riz, Riz1, LOC381568, E330024L24Rik, 4833427P12Rik, KMT8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 110593
HGNC: HGNC:9347
Homologene: 40822
Brpf3
Name: bromodomain and PHD finger containing, 3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268936
Homologene: 16092
Zeb1
Name: zinc finger E-box binding homeobox 1
Synonyms: Nil2, [delta]EF1, MEB1, Tcf8, Zfx1a, Tcf18, AREB6, ZEB, Zfhep, 3110032K11Rik, Zfhx1a, Tw
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 21417
Homologene: 31779
Nedd4l
Name: neural precursor cell expressed, developmentally down-regulated gene 4-like
Synonyms: 1300012C07Rik, Nedd4-2, Nedd4b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 83814
VEGA: 18
HGNC: HGNC:7728
Homologene: 86986
Bptf
Name: bromodomain PHD finger transcription factor
Synonyms: 9430093H17Rik, Falz
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 207165
HGNC: HGNC:3581
Homologene: 114397
Cct4
Name: chaperonin containing TCP1 subunit 4
Synonyms: A45, TCP-1 delta, T complex protein 1, delta, Cctd, 2610204B21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12464
HGNC: HGNC:1617
Homologene: 4695
Atg2b
Name: autophagy related 2B
Synonyms: C630028L02Rik, C030004M05Rik, 2410024A21Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76559
VEGA: 12
Homologene: 9974
Nek1
Name: NIMA (never in mitosis gene a)-related expressed kinase 1
Synonyms: kat, kidney, anemia and testis, D8Ertd790e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18004
HGNC: HGNC:7744
Homologene: 14376
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: nesprin-1, SYNE-1, enaptin165, A330049M09Rik, C130039F11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Pfkp
Name: phosphofructokinase, platelet
Synonyms: PFK-C, 1200015H23Rik, 9330125N24Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56421
HGNC: HGNC:8878
Homologene: 20579
Rae1
Name: ribonucleic acid export 1
Synonyms: MNRP41, MNRP, 41, D2Ertd342e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66679
HGNC: HGNC:9828
Homologene: 2676
Cert1
Name: ceramide transporter 1
Synonyms: 2810404O15Rik, GPBP, 9230101K08Rik, Cert, ceramide transport protein, Col4a3bp
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68018
VEGA: 13
HGNC: HGNC:2205
Homologene: 4173
Cep76
Name: centrosomal protein 76
Synonyms: 6230425F05Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225659
VEGA: 18
Homologene: 11774
2700049A03Rik
Name: RIKEN cDNA 2700049A03 gene
Synonyms: talpid3, Ta3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76967
Homologene: 8839
Pnpla7
Name: patatin-like phospholipase domain containing 7
Synonyms: E430013P11Rik, NRE
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241274
Homologene: 62431
Abca16
Name: ATP-binding cassette, sub-family A member 16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233810
Homologene: 132942
Pdk4
Name: pyruvate dehydrogenase kinase, isoenzyme 4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 27273
HGNC: HGNC:8812
Homologene: 129720
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
F5
Name: coagulation factor V
Synonyms: Cf-5, Cf5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14067
HGNC: HGNC:3542
Homologene: 104
Spta1
Name: spectrin alpha, erythrocytic 1
Synonyms: Spna-1, erythroid, ihj, Spna1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20739
Homologene: 74460
Unc80
Name: unc-80, NALCN activator
Synonyms: C230061B10Rik, C030018G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329178
Homologene: 122243
Ints15
Name: integrator complex subunit 15
Synonyms: E130309D02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231868
Homologene: 11445
Cul9
Name: cullin 9
Synonyms: 1810035I07Rik, Parc
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78309
Homologene: 56696
Tbc1d20
Name: TBC1 domain family, member 20
Synonyms: 1110028I04Rik, 2810442O16Rik, bs
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67231
Homologene: 32574
Or13n4
Name: olfactory receptor family 13 subfamily N member 4
Synonyms: GA_x6K02T2PBJ9-9202245-9201289, MOR260-4, Olfr702
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258590
Homologene: 121512
Rnf185
Name: ring finger protein 185
Synonyms: 1700022N24Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 193670
Homologene: 34298
Dnaaf9
Name: dynein axonemal assembly factor 9
Synonyms: 4930402H24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228602
Homologene: 12623
Gbe1
Name: 1,4-alpha-glucan branching enzyme 1
Synonyms: 2310045H19Rik, 2810426P10Rik, D16Ertd536e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74185
HGNC: HGNC:4180
Homologene: 129
Or1j15
Name: olfactory receptor family 1 subfamily J member 15
Synonyms: GA_x6K02T2NLDC-33262744-33263673, MOR136-12, Olfr344
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258621
Stox2
Name: storkhead box 2
Synonyms: 4933409N07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71069
Homologene: 18414
Mbl1
Name: mannose-binding lectin (protein A) 1
Synonyms: MBL-A, MBP-A
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17194
VEGA: 14
HGNC: HGNC:6921
Homologene: 55449
Flnc
Name: filamin C, gamma
Synonyms: Fln2, 1110055E19Rik, actin binding protein 280
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68794
HGNC: HGNC:3756
Homologene: 37481
Sqor
Name: sulfide quinone oxidoreductase
Synonyms: flavo-binding protein, 4930557M22Rik, 0610039J17Rik, Sqrdl
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 59010
Homologene: 10921
Eif4a3l1
Name: eukaryotic translation initiation factor 4A3 like 1
Synonyms: Gm8994, B020013A22Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 668137
Scaf11
Name: SR-related CTD-associated factor 11
Synonyms: 1110061H03Rik, SRRP129, CASP11, SIP1, 2610510E10Rik, Sfrs2ip, Srsf2ip
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72193
VEGA: 15
Homologene: 37957
Or2n1
Name: olfactory receptor family 2 subfamily N member 1
Synonyms: MOR256-5, GA_x6K02T2PSCP-2623613-2624551, Olfr134
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258829
Homologene: 110603
Foxred2
Name: FAD-dependent oxidoreductase domain containing 2
Synonyms: LOC239554, A430097D04Rik, D15Bwg0759e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239554
Homologene: 11800
Nudt14
Name: nudix hydrolase 14
Synonyms: 1110030M18Rik, nudix (nucleoside diphosphate linked moiety X)-type motif 14
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66174
VEGA: 12
Homologene: 11930
Acan
Name: aggrecan
Synonyms: Cspg1, Agc1, b2b183Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11595
HGNC: HGNC:319
Homologene: 137204
Or4k47
Name: olfactory receptor family 4 subfamily K member 47
Synonyms: GA_x6K02T2Q125-72673494-72672556, MOR248-4, Olfr1297
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258890
Homologene: 115545
Cyp2u1
Name: cytochrome P450, family 2, subfamily u, polypeptide 1
Synonyms: 8430436A10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71519
Homologene: 77704
Kcna3
Name: potassium voltage-gated channel, shaker-related subfamily, member 3
Synonyms: Kv1.3, Kca1-3, Mk-3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16491
HGNC: HGNC:6221
Homologene: 128570
Fam50b
Name: family with sequence similarity 50, member B
Synonyms: XAP-5-like, X5L, D0H6S2654E
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 108161
VEGA: 13
Homologene: 101669
Rsph6a
Name: radial spoke head 6 homolog A (Chlamydomonas)
Synonyms: RSP4, Rshl1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 83434
Homologene: 36476
Pik3c2b
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms: PI3K-C2beta, C330011J12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240752
HGNC: HGNC:8972
Homologene: 20582
Cabyr
Name: calcium binding tyrosine phosphorylation regulated
Synonyms: FSP-2, CBP86, 4933421A18Rik, 1700016C01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 71132
Homologene: 49299
Krtap5-2
Name: keratin associated protein 5-2
Synonyms: 4833428E21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71623
Zfp606
Name: zinc finger protein 606
Synonyms: 2410022M24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67370
Homologene: 23514
Runx3
Name: runt related transcription factor 3
Synonyms: AML2, Cbfa3, Rx3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12399
Homologene: 37914
Susd3
Name: sushi domain containing 3
Synonyms: 2810440J20Rik, 1700017I11Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66329
Homologene: 11948
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 66,549,784 bp
  • C to A, chromosome 1 at 133,079,774 bp
  • T to C, chromosome 1 at 150,649,580 bp
  • A to G, chromosome 1 at 164,219,397 bp
  • T to A, chromosome 1 at 174,184,612 bp
  • T to C, chromosome 2 at 25,051,615 bp
  • T to A, chromosome 2 at 36,569,236 bp
  • A to T, chromosome 2 at 111,621,255 bp
  • G to A, chromosome 2 at 122,804,009 bp
  • C to A, chromosome 2 at 130,806,788 bp
  • C to T, chromosome 2 at 152,311,417 bp
  • T to C, chromosome 2 at 173,008,317 bp
  • T to C, chromosome 3 at 107,036,537 bp
  • T to C, chromosome 3 at 131,291,143 bp
  • T to A, chromosome 4 at 62,615,336 bp
  • A to T, chromosome 4 at 135,121,145 bp
  • A to T, chromosome 4 at 143,180,894 bp
  • C to G, chromosome 5 at 93,273,343 bp
  • A to G, chromosome 5 at 143,307,843 bp
  • A to T, chromosome 6 at 5,487,089 bp
  • A to G, chromosome 6 at 29,450,871 bp
  • A to T, chromosome 6 at 136,329,215 bp
  • T to G, chromosome 7 at 12,494,039 bp
  • C to A, chromosome 7 at 19,065,647 bp
  • T to C, chromosome 7 at 68,187,157 bp
  • A to T, chromosome 7 at 79,086,342 bp
  • T to C, chromosome 7 at 106,824,591 bp
  • T to C, chromosome 7 at 120,427,186 bp
  • GCCACAGCCTCCCTTGCAACCCCCACAGGAGCCACAGCCCCCACAGGAACTACAGCCTCCCTTGCA to GCTACAGCCTCCCTTGCA, chromosome 7 at 142,175,243 bp
  • T to C, chromosome 8 at 47,186,454 bp
  • A to G, chromosome 8 at 61,073,578 bp
  • A to C, chromosome 8 at 116,623,994 bp
  • T to C, chromosome 10 at 5,233,406 bp
  • C to T, chromosome 10 at 45,092,699 bp
  • T to C, chromosome 11 at 3,425,329 bp
  • A to G, chromosome 11 at 22,997,111 bp
  • C to A, chromosome 11 at 94,409,231 bp
  • G to A, chromosome 11 at 107,054,809 bp
  • A to G, chromosome 12 at 71,219,189 bp
  • A to C, chromosome 12 at 105,664,708 bp
  • G to T, chromosome 12 at 112,939,320 bp
  • T to C, chromosome 13 at 6,593,216 bp
  • G to A, chromosome 13 at 34,747,101 bp
  • T to C, chromosome 13 at 49,231,203 bp
  • T to A, chromosome 13 at 96,630,833 bp
  • T to C, chromosome 14 at 41,158,712 bp
  • T to A, chromosome 15 at 77,952,030 bp
  • A to G, chromosome 15 at 96,419,161 bp
  • A to T, chromosome 16 at 59,559,593 bp
  • T to C, chromosome 16 at 70,495,370 bp
  • A to T, chromosome 16 at 81,589,795 bp
  • T to C, chromosome 17 at 28,836,691 bp
  • T to A, chromosome 17 at 38,175,096 bp
  • T to C, chromosome 17 at 46,538,497 bp
  • A to T, chromosome 18 at 5,772,756 bp
  • C to A, chromosome 18 at 12,751,758 bp
  • T to C, chromosome 18 at 64,997,370 bp
  • A to G, chromosome 18 at 67,641,134 bp
  • T to C, chromosome 18 at 76,137,938 bp
  • T to C, chromosome 18 at 77,120,121 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7193 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045334-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.