Strain Name:
C57BL/6J-MtgxR7238Btlr/Mmmh
Stock Number:
045345-MU
Citation ID:
RRID:MMRRC_045345-MU
Other Names:
R7238 (G1)
Major Collection:

Strain Information

Setd5
Name: SET domain containing 5
Synonyms: 2900045N06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72895
Homologene: 12485
Zic4
Name: zinc finger protein of the cerebellum 4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22774
Homologene: 32075
Lhx3
Name: LIM homeobox protein 3
Synonyms: mLim-3, P-LIM, Lim3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16871
HGNC: HGNC:6595
Homologene: 7814
Ppp1cb
Name: protein phosphatase 1 catalytic subunit beta
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19046
HGNC: HGNC:9282
Homologene: 37659
Crlf3
Name: cytokine receptor-like factor 3
Synonyms: Creme9, cytor4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 54394
Homologene: 9327
Spidr
Name: scaffolding protein involved in DNA repair
Synonyms: 2310008H04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224008
VEGA: 16
Homologene: 51693
Ppp1r9a
Name: protein phosphatase 1, regulatory subunit 9A
Synonyms: neurabin-I, NRB, Neurabin I, A230094E16Rik, 4930518N04Rik, 2810430P21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243725
Homologene: 14247
Ap2b1
Name: adaptor-related protein complex 2, beta 1 subunit
Synonyms: 1300012O03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71770
HGNC: HGNC:563
Homologene: 137384
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: C130061D10Rik, Phr1, Pam
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105689
Homologene: 9005
Prdm2
Name: PR domain containing 2, with ZNF domain
Synonyms: KMT8, Riz, Riz1, LOC381568, E330024L24Rik, 4833427P12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 110593
HGNC: HGNC:9347
Homologene: 40822
Exo1
Name: exonuclease 1
Synonyms: 5730442G03Rik, Msa
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26909
HGNC: HGNC:3511
Homologene: 31352
Myo18a
Name: myosin XVIIIA
Synonyms: MyoPDZ
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 360013
Homologene: 7977
Rnf169
Name: ring finger protein 169
Synonyms: 2900057K09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108937
Homologene: 47510
Rsf1
Name: remodeling and spacing factor 1
Synonyms: 4832420A03Rik, XAP8, Hbxap, C030033M12Rik, p325
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Urb1
Name: URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Synonyms: 4921511H13Rik, 5730405K23Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207932
Homologene: 45941
Hspa5
Name: heat shock protein 5
Synonyms: Sez7, 78kDa, Hsce70, mBiP, Grp78, D2Wsu141e, D2Wsu17e, Bip, baffled, XAP-1 antigen
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14828
HGNC: HGNC:5238
Homologene: 3908
Usp10
Name: ubiquitin specific peptidase 10
Synonyms: 2610014N07Rik, Uchrp
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22224
Homologene: 31294
Ptpn6
Name: protein tyrosine phosphatase, non-receptor type 6
Synonyms: hcp, SHP-1, Hcph, Ptp1C
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15170
HGNC: HGNC:9658
Homologene: 56589
Adnp
Name: activity-dependent neuroprotective protein
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11538
Homologene: 7617
Sec23b
Name: SEC23 homolog B, COPII coat complex component
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27054
Homologene: 74571
Gna12
Name: guanine nucleotide binding protein, alpha 12
Synonyms: Galpha12
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14673
HGNC: HGNC:4380
Homologene: 22398
Adgrl1
Name: adhesion G protein-coupled receptor L1
Synonyms: Lphn1, lectomedin-2, 2900070I05Rik, Lec2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330814
Homologene: 8951
Hipk2
Name: homeodomain interacting protein kinase 2
Synonyms: B230339E18Rik, Stank, 1110014O20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15258
Homologene: 68766
Hnrnpl
Name: heterogeneous nuclear ribonucleoprotein L
Synonyms: D830027H13Rik, Hnrpl
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15388
HGNC: HGNC:5045
Homologene: 1174
Mybbp1a
Name: MYB binding protein (P160) 1a
Synonyms: p67MBP, p160MBP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18432
HGNC: HGNC:7546
Homologene: 40954
Tenm4
Name: teneurin transmembrane protein 4
Synonyms: l7Rn3, ELM2, Odz4, Doc4, Ten-m4, l(7)-3Rn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23966
Homologene: 8034
Ankrd34b
Name: ankyrin repeat domain 34B
Synonyms: 6430502M16Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218440
Homologene: 18450
Cdan1
Name: codanin 1
Synonyms: 1500015A01Rik, codanin-1, CDA-I, CDA1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68968
HGNC: HGNC:1713
Homologene: 16324
Hhip
Name: Hedgehog-interacting protein
Synonyms: Hhip1, Hip1, Hip
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 15245
Homologene: 32469
Hspg2
Name: perlecan (heparan sulfate proteoglycan 2)
Synonyms: perlecan, per, Pcn, Plc
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15530
HGNC: HGNC:5273
Homologene: 68473
Eif1ad8
Name: eukaryotic translation initiation factor 1A domain containing 8
Synonyms: Gm8300
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 666806
Homologene: 103865
Mgat5b
Name: mannoside acetylglucosaminyltransferase 5, isoenzyme B
Synonyms: GnT-IX
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268510
Homologene: 27821
Gpatch8
Name: G patch domain containing 8
Synonyms: ENSMUSG00000075516, 5430405G24Rik, Gpatc8, Fbm1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237943
Homologene: 46117
Prkg1
Name: protein kinase, cGMP-dependent, type I
Synonyms: Prkg1b, Prkgr1b
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19091
HGNC: HGNC:9414
Homologene: 55964
Ryr1
Name: ryanodine receptor 1, skeletal muscle
Synonyms: Ryr, calcium release channel isoform 1, skrr
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20190
Homologene: 68069
Immp2l
Name: IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)
Synonyms: IMP2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 93757
Homologene: 6607
Trpc7
Name: transient receptor potential cation channel, subfamily C, member 7
Synonyms: TRP7, Trrp8
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 26946
Homologene: 22689
Sirt4
Name: sirtuin 4
Synonyms: 4930596O17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75387
Homologene: 8164
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Akap3
Name: A kinase anchor protein 3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11642
HGNC: HGNC:373
Homologene: 4688
Ttn
Name: titin
Synonyms: connectin, 1100001C23Rik, D330041I19Rik, D830007G01Rik, 2310074I15Rik, 2310036G12Rik, mdm, 2310057K23Rik, shru, L56
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Dnah2
Name: dynein, axonemal, heavy chain 2
Synonyms: D330014H01Rik, Dnhd3, Dnahc2, 2900022L05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327954
HGNC: HGNC:2948
Homologene: 72110
Pkd1l3
Name: polycystic kidney disease 1 like 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244646
Homologene: 14627
Mx1
Name: MX dynamin-like GTPase 1
Synonyms: Mx, myxovirus (influenza) resistance 1 polypeptide, Mx-1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17857
Chd3
Name: chromodomain helicase DNA binding protein 3
Synonyms: Chd7, 2600010P09Rik, Mi-2 alpha, Prp7, Prp9-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216848
HGNC: HGNC:1918
Homologene: 62693
Pus7
Name: pseudouridylate synthase 7
Synonyms: C330017I15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 78697
Homologene: 6998
Dennd4a
Name: DENN domain containing 4A
Synonyms: F730015K02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102442
VEGA: 9
Homologene: 55933
Nav3
Name: neuron navigator 3
Synonyms: POMFIL1, steerin 3, unc53H3, Pomfil1p, 9630020C08Rik, 4732483H20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 260315
Homologene: 56688
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
Pus3
Name: pseudouridine synthase 3
Synonyms: 5730412F04Rik, 2610020J05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67049
Homologene: 11339
Mink1
Name: misshapen-like kinase 1 (zebrafish)
Synonyms: MINK, Ysk2, Misshapen/NIKs-related kinase, Map4k6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 50932
Homologene: 56762
Slc4a9
Name: solute carrier family 4, sodium bicarbonate cotransporter, member 9
Synonyms: AE4, D630024F24Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240215
VEGA: 18
Homologene: 23732
1110002E22Rik
Name: RIKEN cDNA 1110002E22 gene
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 102634333
Homologene: 131709
Vmn2r61
Name: vomeronasal 2, receptor 61
Synonyms: EG637873, Gprc2a-rs2, Casr-rs2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 637873
Homologene: 129683
Scn5a
Name: sodium channel, voltage-gated, type V, alpha
Synonyms: Nav1.5c, Nav1.5, mH1, SkM2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20271
Homologene: 22738
Atp2c2
Name: ATPase, Ca++ transporting, type 2C, member 2
Synonyms: 1810010G06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69047
Homologene: 73463
Dnaaf9
Name: dynein axonemal assembly factor 9
Synonyms: 4930402H24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228602
Homologene: 12623
Eif2ak2
Name: eukaryotic translation initiation factor 2-alpha kinase 2
Synonyms: IFN- type I-induced and dsRNA-activated kinase, 4732414G15Rik, 2310047A08Rik, Tik, eIF-2 alpha, eIF-2 alpha, Prkr, Pkr, dsRNA-activated kinase, IFN-induced and double-stranded RNA-activated kinase
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19106
HGNC: HGNC:9437
Homologene: 48134
Elac1
Name: elaC ribonuclease Z 1
Synonyms: 2610018O07Rik, 8430417G19Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 114615
Homologene: 10272
Tshz3
Name: teashirt zinc finger family member 3
Synonyms: Tsh3, A630038G13Rik, teashirt3, Zfp537
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243931
Homologene: 10835
Grin2b
Name: glutamate receptor, ionotropic, NMDA2B (epsilon 2)
Synonyms: GluRepsilon2, Nmdar2b, NR2B, NMDAR2B, GluN2B
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14812
HGNC: HGNC:4586
Homologene: 646
Zxdc
Name: ZXD family zinc finger C
Synonyms: B930086F11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 80292
Homologene: 82340
Yipf3
Name: Yip1 domain family, member 3
Synonyms: D17Wsu94e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 28064
Homologene: 9117
Greb1
Name: gene regulated by estrogen in breast cancer protein
Synonyms: 5730583K22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 268527
Homologene: 8780
Col6a4
Name: collagen, type VI, alpha 4
Synonyms: Dvwa, Vwa6, EG235580, 1110001D15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68553
Homologene: 130754
Albfm1
Name: albumin superfamily member 1
Synonyms: 5830473C10Rik, ARG, Gm17754
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 622307
Homologene: 129803
Mroh5
Name: maestro heat-like repeat family member 5
Synonyms: Gm628, LOC268816
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 268816
Vmn1r31
Name: vomeronasal 1 receptor 31
Synonyms: Gm6709
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 626828
Homologene: 115643
Ces1d
Name: carboxylesterase 1D
Synonyms: TGH, Ces3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 104158
HGNC: HGNC:1863
Homologene: 35606
Ercc6l2
Name: excision repair cross-complementing rodent repair deficiency, complementation group 6 like 2
Synonyms: 1700019D06Rik, 9330134C04Rik, 0610007P08Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76251
Homologene: 32564
Krt17
Name: keratin 17
Synonyms: K17, Krt1-17
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16667
HGNC: HGNC:6427
Homologene: 363
Fbxo43
Name: F-box protein 43
Synonyms: 4930533G20Rik, endogenous meiotic inhibitor 2, early mitotic inhibitor 2, Emi2, XErp1 homolog
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78803
VEGA: 15
Homologene: 66393
Cstdc6
Name: cystatin domain containing 6
Synonyms: BC117090, Gm1975
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 100038854
VEGA: 16
HGNC: HGNC:2481
Homologene: 104045
Hmgcl
Name: 3-hydroxy-3-methylglutaryl-Coenzyme A lyase
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15356
HGNC: HGNC:5005
Homologene: 159
Clip1
Name: CAP-GLY domain containing linker protein 1
Synonyms: restin, CLIP-170, Clip 170, Rsn, 1110007I12Rik, 4631429H07Rik, Clip50, cytoplasmic linker protein 50
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56430
Homologene: 74455
Iqce
Name: IQ motif containing E
Synonyms: 1700028P05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74239
Homologene: 49912
Idh1
Name: isocitrate dehydrogenase 1 (NADP+), soluble
Synonyms: E030024J03Rik, IDPc, Id-1, Idh-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15926
HGNC: HGNC:5382
Homologene: 21195
Fbxl12
Name: F-box and leucine-rich repeat protein 12
Synonyms: 3110048D16Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 30843
Homologene: 32198
Or1e26
Name: olfactory receptor family 1 subfamily E member 26
Synonyms: MOR135-3, Olfr385, GA_x6K02T2P1NL-3760313-3759375
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259025
Homologene: 133670
Or13g1
Name: olfactory receptor family 13 subfamily G member 1
Synonyms: MOR251-4P, GA_x6K02T2NHDJ-9801340-9802266, Olfr309
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258196
Homologene: 47595
Musk
Name: muscle, skeletal, receptor tyrosine kinase
Synonyms: Nsk3, Nsk2, MDK4, Nsk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18198
HGNC: HGNC:7525
Homologene: 4084
Vmn2r109
Name: vomeronasal 2, receptor 109
Synonyms: EG627814
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627814
Homologene: 129678
Vmn2r12
Name: vomeronasal 2, receptor 12
Synonyms: Gm6769
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 627569
Homologene: 129606
D130052B06Rik
Name: RIKEN cDNA D130052B06 gene
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216644
VEGA: 11
Hectd2
Name: HECT domain E3 ubiquitin protein ligase 2
Synonyms: A630025O09Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226098
Homologene: 6280
BC051665
Name: cDNA sequence BC051665
Synonyms: cathepsin L-like
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218275
VEGA: 13
Homologene: 74298
Tmcc1
Name: transmembrane and coiled coil domains 1
Synonyms: 3632431M01Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330401
Homologene: 8995
Iigp1c
Name: interferon inducible GTPase 1C
Synonyms: Gm4951
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240327
Slc26a9
Name: solute carrier family 26, member 9
Synonyms: anion transporter/exchanger-9, E030002L01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320718
Homologene: 14179
Selenoo
Name: selenoprotein O
Synonyms: Selo, 1300018J18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223776
Homologene: 69439
Kcnq5
Name: potassium voltage-gated channel, subfamily Q, member 5
Synonyms: 9230107O05Rik, D1Mgi1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226922
HGNC: HGNC:6299
Homologene: 28270
Psg25
Name: pregnancy-specific beta-1-glycoprotein 25
Synonyms: cea13
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 114868
HGNC: HGNC:1819
Homologene: 110989
Gpr137c
Name: G protein-coupled receptor 137C
Synonyms: TM7SF1L2, LOC380893, 6330416L11Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70713
Homologene: 28613
Septin8
Name: septin 8
Synonyms: Sepl, Sept8
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20362
Homologene: 57205
Or1j13
Name: olfactory receptor family 1 subfamily J member 13
Synonyms: Olfr341, MOR136-2, GA_x6K02T2NLDC-33174915-33173974
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258952
Homologene: 74160
Serpina3k
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3K
Synonyms: Spi2, RP54, alpha-1 antiproteinase, MMCM2, MMSpi2, D12Rp54, contrapsin, 1300001I07Rik, Spi-2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20714
HGNC: HGNC:16
Homologene: 111129
Dcaf5
Name: DDB1 and CUL4 associated factor 5
Synonyms: Wdr22, BCRP2, 9430020B07Rik, BCRG2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320808
VEGA: 12
Homologene: 18564
Pecr
Name: peroxisomal trans-2-enoyl-CoA reductase
Synonyms: 2400003B18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 111175
Homologene: 69255
Or5k15
Name: olfactory receptor family 5 subfamily J member 15
Synonyms: MOR184-6, Olfr178, GA_x54KRFPKG5P-55108059-55107100
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258999
Homologene: 79412
Lrrc73
Name: leucine rich repeat containing 73
Synonyms: Gm88, LOC224813
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224813
VEGA: 17
Homologene: 19183
Or14j6
Name: olfactory receptor family 14 subfamily J member 6
Synonyms: Olfr127, MOR218-7, GA_x6K02T2PSCP-2354126-2355093
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258374
Homologene: 134080
Adig
Name: adipogenin
Synonyms: SMAF1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 246747
Tmem52b
Name: transmembrane protein 52B
Synonyms: D630042F21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330428
Homologene: 27407
Speer1m
Name: spermatogenesis associated glutamate (E)-rich protein 1M
Synonyms: 4933402N22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 545732
Homologene: 69402
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 21,402,302 bp
  • A to G, chromosome 1 at 65,166,125 bp
  • T to C, chromosome 1 at 72,259,433 bp
  • T to A, chromosome 1 at 131,758,818 bp
  • T to C, chromosome 1 at 175,888,847 bp
  • T to C, chromosome 2 at 26,202,997 bp
  • T to C, chromosome 2 at 34,772,371 bp
  • T to A, chromosome 2 at 36,479,714 bp
  • T to C, chromosome 2 at 76,712,205 bp
  • G to A, chromosome 2 at 76,881,328 bp
  • T to A, chromosome 2 at 82,982,140 bp
  • G to T, chromosome 2 at 120,730,302 bp
  • C to A, chromosome 2 at 130,806,788 bp
  • A to G, chromosome 2 at 144,590,338 bp
  • T to A, chromosome 2 at 158,505,853 bp
  • T to G, chromosome 2 at 168,183,967 bp
  • A to G, chromosome 3 at 38,890,413 bp
  • A to T, chromosome 3 at 138,069,951 bp
  • G to A, chromosome 4 at 58,344,312 bp
  • T to C, chromosome 4 at 135,962,113 bp
  • T to C, chromosome 4 at 137,508,393 bp
  • A to G, chromosome 4 at 143,135,821 bp
  • T to C, chromosome 5 at 11,920,745 bp
  • T to C, chromosome 5 at 23,778,452 bp
  • A to T, chromosome 5 at 32,491,032 bp
  • A to T, chromosome 5 at 90,579,660 bp
  • G to A, chromosome 5 at 109,097,789 bp
  • A to T, chromosome 5 at 115,482,990 bp
  • C to T, chromosome 5 at 123,613,265 bp
  • G to A, chromosome 5 at 140,689,958 bp
  • A to G, chromosome 5 at 140,830,092 bp
  • G to T, chromosome 6 at 5,159,716 bp
  • G to T, chromosome 6 at 38,716,057 bp
  • A to T, chromosome 6 at 58,472,873 bp
  • T to A, chromosome 6 at 90,369,660 bp
  • G to A, chromosome 6 at 113,121,130 bp
  • G to A, chromosome 6 at 116,134,237 bp
  • A to G, chromosome 6 at 124,721,858 bp
  • A to G, chromosome 6 at 126,865,237 bp
  • A to G, chromosome 6 at 129,516,688 bp
  • T to C, chromosome 6 at 135,780,251 bp
  • C to T, chromosome 7 at 18,532,202 bp
  • T to A, chromosome 7 at 28,813,975 bp
  • C to T, chromosome 7 at 29,095,382 bp
  • T to C, chromosome 7 at 36,770,097 bp
  • T to A, chromosome 7 at 42,267,205 bp
  • T to C, chromosome 7 at 86,306,591 bp
  • G to A, chromosome 7 at 96,553,496 bp
  • GGCGGCGGC to GGCGGCGGCCGCGGCGGC, chromosome 7 at 97,579,921 bp
  • A to G, chromosome 7 at 99,925,747 bp
  • T to A, chromosome 7 at 141,809,517 bp
  • G to C, chromosome 7 at 141,809,687 bp
  • C to T, chromosome 8 at 79,987,012 bp
  • T to A, chromosome 8 at 83,939,064 bp
  • C to T, chromosome 8 at 93,178,135 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • A to G, chromosome 8 at 119,742,421 bp
  • T to C, chromosome 8 at 119,941,544 bp
  • G to T, chromosome 9 at 20,618,413 bp
  • A to G, chromosome 9 at 35,566,669 bp
  • C to A, chromosome 9 at 64,861,956 bp
  • A to T, chromosome 9 at 91,379,397 bp
  • C to T, chromosome 9 at 106,000,320 bp
  • T to C, chromosome 9 at 119,491,544 bp
  • T to A, chromosome 10 at 109,853,324 bp
  • A to G, chromosome 11 at 33,623,594 bp
  • T to G, chromosome 11 at 53,536,692 bp
  • T to C, chromosome 11 at 69,364,047 bp
  • A to G, chromosome 11 at 69,459,146 bp
  • T to C, chromosome 11 at 70,611,479 bp
  • G to T, chromosome 11 at 72,443,512 bp
  • A to T, chromosome 11 at 73,589,735 bp
  • G to A, chromosome 11 at 77,842,233 bp
  • T to C, chromosome 11 at 80,056,525 bp
  • T to G, chromosome 11 at 83,333,122 bp
  • T to A, chromosome 11 at 100,257,787 bp
  • C to A, chromosome 11 at 102,478,528 bp
  • T to C, chromosome 11 at 116,984,983 bp
  • A to G, chromosome 12 at 16,674,672 bp
  • T to C, chromosome 12 at 41,110,916 bp
  • G to T, chromosome 12 at 80,338,709 bp
  • A to T, chromosome 12 at 87,517,236 bp
  • T to A, chromosome 12 at 104,343,108 bp
  • A to T, chromosome 13 at 56,826,897 bp
  • G to A, chromosome 13 at 60,782,722 bp
  • A to G, chromosome 13 at 63,865,984 bp
  • T to C, chromosome 13 at 92,438,631 bp
  • A to G, chromosome 14 at 45,278,691 bp
  • A to G, chromosome 14 at 103,156,297 bp
  • T to C, chromosome 15 at 36,151,825 bp
  • T to G, chromosome 15 at 73,791,429 bp
  • T to A, chromosome 15 at 89,089,224 bp
  • A to T, chromosome 16 at 15,966,816 bp
  • C to T, chromosome 16 at 36,321,831 bp
  • T to A, chromosome 16 at 58,889,889 bp
  • T to C, chromosome 16 at 90,752,115 bp
  • A to G, chromosome 16 at 97,448,296 bp
  • C to T, chromosome 17 at 20,541,074 bp
  • T to C, chromosome 17 at 37,904,437 bp
  • T to C, chromosome 17 at 46,251,659 bp
  • G to A, chromosome 17 at 46,254,562 bp
  • C to T, chromosome 17 at 78,866,331 bp
  • A to G, chromosome 18 at 36,529,720 bp
  • A to G, chromosome 18 at 60,246,283 bp
  • C to T, chromosome 18 at 73,739,288 bp
  • C to T, chromosome 19 at 30,624,690 bp
  • A to T, chromosome 19 at 36,597,078 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7238 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045345-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.