Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7238Btlr/Mmmh
Stock Number:
045345-MU
Citation ID:
RRID:MMRRC_045345-MU
Other Names:
R7238 (G1)
Major Collection:

Strain Information

Setd5
Name: SET domain containing 5
Synonyms: 2900045N06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72895
Homologene: 12485
Zic4
Name: zinc finger protein of the cerebellum 4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22774
Homologene: 32075
Lhx3
Name: LIM homeobox protein 3
Synonyms: P-LIM, mLim-3, Lim3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16871
HGNC: HGNC:6595
Homologene: 7814
Ppp1cb
Name: protein phosphatase 1 catalytic subunit beta
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19046
HGNC: HGNC:9282
Homologene: 37659
Crlf3
Name: cytokine receptor-like factor 3
Synonyms: cytor4, Creme9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 54394
Homologene: 9327
Spidr
Name: scaffolding protein involved in DNA repair
Synonyms: 2310008H04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224008
VEGA: 16
Homologene: 51693
Ppp1r9a
Name: protein phosphatase 1, regulatory subunit 9A
Synonyms: 4930518N04Rik, neurabin-I, A230094E16Rik, 2810430P21Rik, Neurabin I, NRB
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243725
Homologene: 14247
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 21,402,302 bp
  • A to G, chromosome 1 at 65,166,125 bp
  • T to C, chromosome 1 at 72,259,433 bp
  • T to A, chromosome 1 at 131,758,818 bp
  • T to C, chromosome 1 at 175,888,847 bp
  • T to C, chromosome 2 at 26,202,997 bp
  • T to C, chromosome 2 at 34,772,371 bp
  • T to A, chromosome 2 at 36,479,714 bp
  • T to C, chromosome 2 at 76,712,205 bp
  • G to A, chromosome 2 at 76,881,328 bp
  • T to A, chromosome 2 at 82,982,140 bp
  • G to T, chromosome 2 at 120,730,302 bp
  • C to A, chromosome 2 at 130,806,788 bp
  • A to G, chromosome 2 at 144,590,338 bp
  • T to A, chromosome 2 at 158,505,853 bp
  • T to G, chromosome 2 at 168,183,967 bp
  • A to G, chromosome 3 at 38,890,413 bp
  • A to T, chromosome 3 at 138,069,951 bp
  • G to A, chromosome 4 at 58,344,312 bp
  • T to C, chromosome 4 at 135,962,113 bp
  • T to C, chromosome 4 at 137,508,393 bp
  • A to G, chromosome 4 at 143,135,821 bp
  • T to C, chromosome 5 at 11,920,745 bp
  • T to C, chromosome 5 at 23,778,452 bp
  • A to T, chromosome 5 at 32,491,032 bp
  • A to T, chromosome 5 at 90,579,660 bp
  • G to A, chromosome 5 at 109,097,789 bp
  • A to T, chromosome 5 at 115,482,990 bp
  • C to T, chromosome 5 at 123,613,265 bp
  • G to A, chromosome 5 at 140,689,958 bp
  • A to G, chromosome 5 at 140,830,092 bp
  • G to T, chromosome 6 at 5,159,716 bp
  • G to T, chromosome 6 at 38,716,057 bp
  • A to T, chromosome 6 at 58,472,873 bp
  • T to A, chromosome 6 at 90,369,660 bp
  • G to A, chromosome 6 at 113,121,130 bp
  • G to A, chromosome 6 at 116,134,237 bp
  • A to G, chromosome 6 at 124,721,858 bp
  • A to G, chromosome 6 at 126,865,237 bp
  • A to G, chromosome 6 at 129,516,688 bp
  • T to C, chromosome 6 at 135,780,251 bp
  • C to T, chromosome 7 at 18,532,202 bp
  • T to A, chromosome 7 at 28,813,975 bp
  • C to T, chromosome 7 at 29,095,382 bp
  • T to C, chromosome 7 at 36,770,097 bp
  • T to A, chromosome 7 at 42,267,205 bp
  • T to C, chromosome 7 at 86,306,591 bp
  • G to A, chromosome 7 at 96,553,496 bp
  • GGCGGCGGC to GGCGGCGGCCGCGGCGGC, chromosome 7 at 97,579,921 bp
  • A to G, chromosome 7 at 99,925,747 bp
  • T to A, chromosome 7 at 141,809,517 bp
  • G to C, chromosome 7 at 141,809,687 bp
  • C to T, chromosome 8 at 79,987,012 bp
  • T to A, chromosome 8 at 83,939,064 bp
  • C to T, chromosome 8 at 93,178,135 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • A to G, chromosome 8 at 119,742,421 bp
  • T to C, chromosome 8 at 119,941,544 bp
  • G to T, chromosome 9 at 20,618,413 bp
  • A to G, chromosome 9 at 35,566,669 bp
  • C to A, chromosome 9 at 64,861,956 bp
  • A to T, chromosome 9 at 91,379,397 bp
  • C to T, chromosome 9 at 106,000,320 bp
  • T to C, chromosome 9 at 119,491,544 bp
  • T to A, chromosome 10 at 109,853,324 bp
  • A to G, chromosome 11 at 33,623,594 bp
  • T to G, chromosome 11 at 53,536,692 bp
  • T to C, chromosome 11 at 69,364,047 bp
  • A to G, chromosome 11 at 69,459,146 bp
  • T to C, chromosome 11 at 70,611,479 bp
  • G to T, chromosome 11 at 72,443,512 bp
  • A to T, chromosome 11 at 73,589,735 bp
  • G to A, chromosome 11 at 77,842,233 bp
  • T to C, chromosome 11 at 80,056,525 bp
  • T to G, chromosome 11 at 83,333,122 bp
  • T to A, chromosome 11 at 100,257,787 bp
  • C to A, chromosome 11 at 102,478,528 bp
  • T to C, chromosome 11 at 116,984,983 bp
  • A to G, chromosome 12 at 16,674,672 bp
  • T to C, chromosome 12 at 41,110,916 bp
  • G to T, chromosome 12 at 80,338,709 bp
  • A to T, chromosome 12 at 87,517,236 bp
  • T to A, chromosome 12 at 104,343,108 bp
  • A to T, chromosome 13 at 56,826,897 bp
  • G to A, chromosome 13 at 60,782,722 bp
  • A to G, chromosome 13 at 63,865,984 bp
  • T to C, chromosome 13 at 92,438,631 bp
  • A to G, chromosome 14 at 45,278,691 bp
  • A to G, chromosome 14 at 103,156,297 bp
  • T to C, chromosome 15 at 36,151,825 bp
  • T to G, chromosome 15 at 73,791,429 bp
  • T to A, chromosome 15 at 89,089,224 bp
  • A to T, chromosome 16 at 15,966,816 bp
  • C to T, chromosome 16 at 36,321,831 bp
  • T to A, chromosome 16 at 58,889,889 bp
  • T to C, chromosome 16 at 90,752,115 bp
  • A to G, chromosome 16 at 97,448,296 bp
  • C to T, chromosome 17 at 20,541,074 bp
  • T to C, chromosome 17 at 37,904,437 bp
  • T to C, chromosome 17 at 46,251,659 bp
  • G to A, chromosome 17 at 46,254,562 bp
  • C to T, chromosome 17 at 78,866,331 bp
  • A to G, chromosome 18 at 36,529,720 bp
  • A to G, chromosome 18 at 60,246,283 bp
  • C to T, chromosome 18 at 73,739,288 bp
  • C to T, chromosome 19 at 30,624,690 bp
  • A to T, chromosome 19 at 36,597,078 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7238 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045345-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.