Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7240Btlr/Mmmh
Stock Number:
045347-MU
Citation ID:
RRID:MMRRC_045347-MU
Other Names:
R7240 (G1)
Major Collection:

Strain Information

Atn1
Name: atrophin 1
Synonyms: atrophin-1, Atr1, Drpla
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13498
HGNC: HGNC:3033
Homologene: 1461
Scn3a
Name: sodium channel, voltage-gated, type III, alpha
Synonyms: LOC381367, Nav1.3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20269
Homologene: 56005
Iqgap1
Name: IQ motif containing GTPase activating protein 1
Synonyms: D7Ertd237e, D7Ertd257e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 29875
HGNC: HGNC:6110
Homologene: 74514
Ccdc88c
Name: coiled-coil domain containing 88C
Synonyms: Daple, 0610010D24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68339
VEGA: 12
Homologene: 18903
Gnai2
Name: G protein subunit alpha i2
Synonyms: Gia, Gnai-2, Galphai2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14678
HGNC: HGNC:4385
Homologene: 55539
Rbm6
Name: RNA binding motif protein 6
Synonyms: NY-LU-12, g16, Def-3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19654
HGNC: HGNC:9903
Homologene: 31336
Cdk5rap2
Name: CDK5 regulatory subunit associated protein 2
Synonyms: 2900018K03Rik, an
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 214444
Homologene: 49533
Aspm
Name: abnormal spindle microtubule assembly
Synonyms: Sha1, Aspm, D330028K02Rik, MCPH5, Calmbp1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12316
Homologene: 7650
Tdrd3
Name: tudor domain containing 3
Synonyms: 4732418C03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219249
Homologene: 12771
Rnpc3
Name: RNA-binding region (RNP1, RRM) containing 3
Synonyms: C030014B17Rik, 2810441O16Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67225
Homologene: 9746
N4bp2
Name: NEDD4 binding protein 2
Synonyms: LOC333789, LOC386488, B3bp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 333789
Homologene: 32396
Puf60
Name: poly-U binding splicing factor 60
Synonyms: 2810454F19Rik, 2410104I19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67959
VEGA: 15
Homologene: 8614
Lamc1
Name: laminin, gamma 1
Synonyms: Lamb2, laminin B2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226519
HGNC: HGNC:6492
Homologene: 1724
Cdh19
Name: cadherin 19, type 2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227485
HGNC: HGNC:1758
Homologene: 23286
E4f1
Name: E4F transcription factor 1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13560
VEGA: 17
HGNC: HGNC:3121
Homologene: 3259
Tpst2
Name: protein-tyrosine sulfotransferase 2
Synonyms: grm, D5Ucla3, grt, Tango13b
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22022
Homologene: 2666
Tmc2
Name: transmembrane channel-like gene family 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 192140
Homologene: 25877
Trpm2
Name: transient receptor potential cation channel, subfamily M, member 2
Synonyms: Trrp7, LTRPC2, TRPC7, 9830168K16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 28240
Homologene: 20709
Ryr1
Name: ryanodine receptor 1, skeletal muscle
Synonyms: calcium release channel isoform 1, Ryr, skrr
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20190
Homologene: 68069
Rundc1
Name: RUN domain containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217201
Homologene: 15095
Rnase9
Name: ribonuclease, RNase A family, 9 (non-active)
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 328401
VEGA: 14
Homologene: 18830
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Ush2a
Name: usherin
Synonyms: MUSH2A, A930011D15Rik, LOC381317, LOC269160, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Pcdhgb8
Name: protocadherin gamma subfamily B, 8
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93705
Homologene: 81868
Slc22a29
Name: solute carrier family 22. member 29
Synonyms: D630002G06Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 236293
Homologene: 77136
Cd69
Name: CD69 antigen
Synonyms: VEA, AIM, 5830438K24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12515
HGNC: HGNC:1694
Homologene: 128584
Ofcc1
Name: orofacial cleft 1 candidate 1
Synonyms: ojoplano, Opo
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218165
VEGA: 13
Homologene: 125376
Notch4
Name: notch 4
Synonyms: Int-3, Int3, N4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18132
HGNC: HGNC:7884
Homologene: 3351
Ntn4
Name: netrin 4
Synonyms: beta-netrin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 57764
Homologene: 10934
Dstyk
Name: dual serine/threonine and tyrosine protein kinase
Synonyms: A930019K20Rik, C430014H23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213452
Homologene: 19711
Dsg1c
Name: desmoglein 1 gamma
Synonyms: Dsg6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 211924
HGNC: HGNC:3048
Sipa1l2
Name: signal-induced proliferation-associated 1 like 2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244668
Homologene: 18956
Parpbp
Name: PARP1 binding protein
Synonyms: 4930547N16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75317
Homologene: 49519
Zfp777
Name: zinc finger protein 777
Synonyms: 2500002G23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72306
Homologene: 56721
Or2a7
Name: olfactory receptor family 2 subfamily A member 7
Synonyms: MOR261-6, GA_x6K02T2P3E9-4384160-4383228, Olfr13
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18310
Homologene: 27232
Cd300c
Name: CD300C molecule
Synonyms: Clm6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 387565
Homologene: 74580
Iqca1
Name: IQ motif containing with AAA domain 1
Synonyms: 4930585L22Rik, 4930465P12Rik, Iqca
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74918
Homologene: 49784
D130052B06Rik
Name: RIKEN cDNA D130052B06 gene
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216644
VEGA: 11
Vmn2r95
Name: vomeronasal 2, receptor 95
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328759
Homologene: 115024
Mfap3
Name: microfibrillar-associated protein 3
Synonyms: 2700079M14Rik, 2610509F16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216760
HGNC: HGNC:7034
Homologene: 4333
Or8g24
Name: olfactory receptor family 8 subfamily G member 24
Synonyms: GA_x6K02T2PVTD-32774646-32773699, MOR171-25, Olfr938
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258430
VEGA: 9
Or10j2
Name: olfactory receptor family 10 subfamily J member 2
Synonyms: GA_x6K02T2P20D-20826777-20827719, GA_x6K02T2R7CC-581296-580364, MOR267-12P, MOR267-8, Olfr1403, Olfr418-ps1, Olfr418
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258645
HGNC: HGNC:8175
Homologene: 8218
Trbv21
Name: T cell receptor beta, variable 21
Synonyms: Gm16778, Tcrb-V19
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 100124686
Or5p55
Name: olfactory receptor family 5 subfamily P member 55
Synonyms: GA_x6K02T2PBJ9-10296787-10297719, MOR204-3, Olfr476
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258926
Or5p72
Name: olfactory receptor family 5 subfamily P member 72
Synonyms: GA_x6K02T2PBJ9-10752603-10753547, MOR204-9, Olfr497
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258733
Homologene: 133602
Pla2g4d
Name: phospholipase A2, group IVD
Synonyms: 2610311B01Rik, Pla2delta
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78390
Homologene: 52252
Serpina3k
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3K
Synonyms: contrapsin, Spi-2, D12Rp54, RP54, Spi2, MMSpi2, MMCM2, alpha-1 antiproteinase, 1300001I07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20714
HGNC: HGNC:16
Homologene: 111129
Catsper2
Name: cation channel, sperm associated 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 212670
Homologene: 77423
Krtap10-26
Name: keratin associated protein 10-26
Synonyms: Gm7138
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 102640500
VEGA: 10
Homologene: 115744
Or8b55
Name: olfactory receptor family 8 subfamily B member 55
Synonyms: GA_x6K02T2PVTD-32518237-32519172, MOR161-3, Olfr922
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258777
VEGA: 9
Homologene: 27262
Dpf1
Name: double PHD fingers 1
Synonyms: neuro-d4, Neud4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 29861
Homologene: 3415
2210017I01Rik
Name: RIKEN cDNA 2210017I01 gene
Type: Gene
Species: Mouse
Chromosome: 3
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 90,070,550 bp
  • T to C, chromosome 1 at 110,893,407 bp
  • G to A, chromosome 1 at 132,454,123 bp
  • C to T, chromosome 1 at 139,478,651 bp
  • A to G, chromosome 1 at 153,234,650 bp
  • T to C, chromosome 1 at 173,270,994 bp
  • A to G, chromosome 1 at 188,911,661 bp
  • A to T, chromosome 2 at 65,469,042 bp
  • A to G, chromosome 2 at 76,848,990 bp
  • T to C, chromosome 2 at 120,270,349 bp
  • TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT to TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT, chromosome 2 at 121,397,572 bp
  • C to T, chromosome 2 at 130,234,804 bp
  • A to G, chromosome 3 at 92,605,075 bp
  • T to A, chromosome 3 at 113,616,831 bp
  • T to A, chromosome 4 at 70,291,908 bp
  • T to A, chromosome 5 at 65,794,545 bp
  • T to C, chromosome 5 at 112,307,678 bp
  • A to T, chromosome 6 at 41,202,958 bp
  • A to G, chromosome 6 at 43,174,501 bp
  • A to G, chromosome 6 at 48,044,449 bp
  • A to T, chromosome 6 at 124,747,898 bp
  • A to T, chromosome 6 at 129,270,042 bp
  • T to C, chromosome 7 at 29,052,015 bp
  • T to A, chromosome 7 at 29,311,627 bp
  • A to T, chromosome 7 at 80,759,839 bp
  • T to C, chromosome 7 at 107,968,188 bp
  • A to G, chromosome 7 at 108,422,933 bp
  • A to G, chromosome 8 at 125,469,860 bp
  • A to G, chromosome 9 at 38,815,713 bp
  • A to T, chromosome 9 at 39,078,610 bp
  • A to C, chromosome 9 at 107,615,773 bp
  • A to T, chromosome 9 at 107,852,896 bp
  • T to C, chromosome 10 at 77,776,755 bp
  • A to G, chromosome 10 at 77,935,876 bp
  • G to A, chromosome 10 at 88,124,940 bp
  • A to G, chromosome 10 at 93,745,741 bp
  • A to G, chromosome 11 at 33,623,874 bp
  • A to G, chromosome 11 at 57,529,756 bp
  • T to C, chromosome 11 at 101,431,548 bp
  • A to G, chromosome 11 at 114,959,783 bp
  • C to T, chromosome 12 at 100,944,939 bp
  • T to G, chromosome 12 at 104,340,602 bp
  • A to G, chromosome 13 at 40,208,841 bp
  • A to C, chromosome 14 at 51,038,979 bp
  • A to G, chromosome 14 at 87,458,803 bp
  • A to G, chromosome 15 at 76,072,539 bp
  • A to G, chromosome 17 at 18,451,963 bp
  • T to A, chromosome 17 at 24,444,325 bp
  • A to G, chromosome 17 at 34,576,471 bp
  • T to C, chromosome 18 at 20,283,109 bp
  • G to A, chromosome 18 at 37,763,703 bp
  • A to G, chromosome 19 at 8,161,511 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7240 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045347-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.