Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7240Btlr/Mmmh
Stock Number:
045347-MU
Citation ID:
RRID:MMRRC_045347-MU
Other Names:
R7240 (G1)
Major Collection:

Strain Information

Atn1
Name: atrophin 1
Synonyms: atrophin-1, Atr1, Drpla
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13498
HGNC: HGNC:3033
Homologene: 1461
Scn3a
Name: sodium channel, voltage-gated, type III, alpha
Synonyms: LOC381367, Nav1.3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20269
Homologene: 56005
Iqgap1
Name: IQ motif containing GTPase activating protein 1
Synonyms: D7Ertd237e, D7Ertd257e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 29875
HGNC: HGNC:6110
Homologene: 74514
Ccdc88c
Name: coiled-coil domain containing 88C
Synonyms: Daple, 0610010D24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68339
VEGA: 12
Homologene: 18903
Gnai2
Name: G protein subunit alpha i2
Synonyms: Gia, Gnai-2, Galphai2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14678
HGNC: HGNC:4385
Homologene: 55539
Rbm6
Name: RNA binding motif protein 6
Synonyms: NY-LU-12, g16, Def-3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19654
HGNC: HGNC:9903
Homologene: 31336
Cdk5rap2
Name: CDK5 regulatory subunit associated protein 2
Synonyms: 2900018K03Rik, an
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 214444
Homologene: 49533
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 90,070,550 bp
  • T to C, chromosome 1 at 110,893,407 bp
  • G to A, chromosome 1 at 132,454,123 bp
  • C to T, chromosome 1 at 139,478,651 bp
  • A to G, chromosome 1 at 153,234,650 bp
  • T to C, chromosome 1 at 173,270,994 bp
  • A to G, chromosome 1 at 188,911,661 bp
  • A to T, chromosome 2 at 65,469,042 bp
  • A to G, chromosome 2 at 76,848,990 bp
  • T to C, chromosome 2 at 120,270,349 bp
  • TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT to TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT, chromosome 2 at 121,397,572 bp
  • C to T, chromosome 2 at 130,234,804 bp
  • A to G, chromosome 3 at 92,605,075 bp
  • T to A, chromosome 3 at 113,616,831 bp
  • T to A, chromosome 4 at 70,291,908 bp
  • T to A, chromosome 5 at 65,794,545 bp
  • T to C, chromosome 5 at 112,307,678 bp
  • A to T, chromosome 6 at 41,202,958 bp
  • A to G, chromosome 6 at 43,174,501 bp
  • A to G, chromosome 6 at 48,044,449 bp
  • A to T, chromosome 6 at 124,747,898 bp
  • A to T, chromosome 6 at 129,270,042 bp
  • T to C, chromosome 7 at 29,052,015 bp
  • T to A, chromosome 7 at 29,311,627 bp
  • A to T, chromosome 7 at 80,759,839 bp
  • T to C, chromosome 7 at 107,968,188 bp
  • A to G, chromosome 7 at 108,422,933 bp
  • A to G, chromosome 8 at 125,469,860 bp
  • A to G, chromosome 9 at 38,815,713 bp
  • A to T, chromosome 9 at 39,078,610 bp
  • A to C, chromosome 9 at 107,615,773 bp
  • A to T, chromosome 9 at 107,852,896 bp
  • T to C, chromosome 10 at 77,776,755 bp
  • A to G, chromosome 10 at 77,935,876 bp
  • G to A, chromosome 10 at 88,124,940 bp
  • A to G, chromosome 10 at 93,745,741 bp
  • A to G, chromosome 11 at 33,623,874 bp
  • A to G, chromosome 11 at 57,529,756 bp
  • T to C, chromosome 11 at 101,431,548 bp
  • A to G, chromosome 11 at 114,959,783 bp
  • C to T, chromosome 12 at 100,944,939 bp
  • T to G, chromosome 12 at 104,340,602 bp
  • A to G, chromosome 13 at 40,208,841 bp
  • A to C, chromosome 14 at 51,038,979 bp
  • A to G, chromosome 14 at 87,458,803 bp
  • A to G, chromosome 15 at 76,072,539 bp
  • A to G, chromosome 17 at 18,451,963 bp
  • T to A, chromosome 17 at 24,444,325 bp
  • A to G, chromosome 17 at 34,576,471 bp
  • T to C, chromosome 18 at 20,283,109 bp
  • G to A, chromosome 18 at 37,763,703 bp
  • A to G, chromosome 19 at 8,161,511 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7240 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045347-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.