Strain Name:
C57BL/6J-MtgxR7362Btlr/Mmmh
Stock Number:
045375-MU
Citation ID:
RRID:MMRRC_045375-MU
Other Names:
R7362 (G1)
Major Collection:

Strain Information

Inpp5a
Name: inositol polyphosphate-5-phosphatase A
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 212111
HGNC: HGNC:6076
Homologene: 4045
Dgat2
Name: diacylglycerol O-acyltransferase 2
Synonyms: 0610010B06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67800
Homologene: 23580
Wdr73
Name: WD repeat domain 73
Synonyms: 2410008B13Rik, 1200011I23Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71968
Homologene: 41899
Pcf11
Name: PCF11 cleavage and polyadenylation factor subunit
Synonyms: 5730417B17Rik, 2500001H09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74737
Homologene: 32282
Uck2
Name: uridine-cytidine kinase 2
Synonyms: Umpk, TSA903
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 80914
Homologene: 40850
Mier3
Name: MIER family member 3
Synonyms: D130064H19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218613
Homologene: 18196
Rock2
Name: Rho-associated coiled-coil containing protein kinase 2
Synonyms: Rho-kinase, ROKalpha, Rock2m, B230113H15Rik, Rock-II
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 19878
VEGA: 12
Homologene: 21010
Dhdds
Name: dehydrodolichyl diphosphate synthase
Synonyms: 3222401G21Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67422
Homologene: 32615
Bicd1
Name: BICD cargo adaptor 1
Synonyms: B830009D06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12121
HGNC: HGNC:1049
Homologene: 37518
Tram1
Name: translocating chain-associating membrane protein 1
Synonyms: TRAMP, 1810049E02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72265
Homologene: 8621
Myt1
Name: myelin transcription factor 1
Synonyms: NZF-2a, Nztf2, NZF-2b, Nzf2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17932
HGNC: HGNC:7622
Homologene: 3332
Ern1
Name: endoplasmic reticulum to nucleus signalling 1
Synonyms: Ire1a, Ire1p, 9030414B18Rik, Ire1alpha
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78943
HGNC: HGNC:3449
Homologene: 55580
Kansl3
Name: KAT8 regulatory NSL complex subunit 3
Synonyms: 4632411B12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226976
Homologene: 9949
Gsx2
Name: GS homeobox 2
Synonyms: Gsh-2, Gsh2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14843
Homologene: 15377
Eps15
Name: epidermal growth factor receptor pathway substrate 15
Synonyms: 2410112D09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13858
HGNC: HGNC:3419
Homologene: 128359
Ppp3cb
Name: protein phosphatase 3, catalytic subunit, beta isoform
Synonyms: PP2BA beta, Calnb, Cnab, CnAbeta, 1110063J16Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19056
HGNC: HGNC:9315
Homologene: 56429
Mkln1
Name: muskelin 1, intracellular mediator containing kelch motifs
Synonyms: A130067F06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 27418
HGNC: HGNC:7109
Homologene: 8305
Tecpr2
Name: tectonin beta-propeller repeat containing 2
Synonyms: 4930573I19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104859
VEGA: 12
Homologene: 8897
Ssh2
Name: slingshot protein phosphatase 2
Synonyms: SSH-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237860
Homologene: 14116
Egfem1
Name: EGF-like and EMI domain containing 1
Synonyms: 6130401L20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75740
Homologene: 135950
Lrrc37a
Name: leucine rich repeat containing 37A
Synonyms: LOC237954
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237954
Homologene: 138824
Pkd1l3
Name: polycystic kidney disease 1 like 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244646
Homologene: 14627
Ugcg
Name: UDP-glucose ceramide glucosyltransferase
Synonyms: Ugcgl, Epcs21, GlcT-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22234
Homologene: 37763
Ccser1
Name: coiled-coil serine rich 1
Synonyms: Fam190a, 6230405M12Rik, C130092O11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232035
Homologene: 28086
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239420
Homologene: 65982
Grhpr
Name: glyoxylate reductase/hydroxypyruvate reductase
Synonyms: 6430629L09Rik, 1110059D05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76238
HGNC: HGNC:4570
Homologene: 49088
Wdr91
Name: WD repeat domain 91
Synonyms: 9530020G05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101240
Homologene: 8562
Vmn2r82
Name: vomeronasal 2, receptor 82
Synonyms: EG624845
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 624845
Homologene: 83483
Aoc1
Name: amine oxidase, copper-containing 1
Synonyms: Abp1, 1600012D06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 76507
HGNC: HGNC:80
Homologene: 68159
Slco1c1
Name: solute carrier organic anion transporter family, member 1c1
Synonyms: Slc21a14, OATP-F
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 58807
Homologene: 23008
Spata31h1
Name: SPATA31 subfamily H member 1
Synonyms: 4932415D10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 102635990
VEGA: 10
Homologene: 82476
Zfp454
Name: zinc finger protein 454
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237758
Homologene: 72226
Bfsp1
Name: beaded filament structural protein 1, in lens-CP94
Synonyms: filensin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12075
HGNC: HGNC:1040
Homologene: 922
Vwa5b1
Name: von Willebrand factor A domain containing 5B1
Synonyms: 4931403E03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75718
Homologene: 19431
Or52s1
Name: olfactory receptor family 52 subfamily S member 1
Synonyms: Olfr593, MOR24-2, GA_x6K02T2PBJ9-5927412-5928362
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258378
Homologene: 27147
Simc1
Name: SUMO-interacting motifs containing 1
Synonyms: 4732471D19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 319719
Homologene: 131217
Adprhl1
Name: ADP-ribosylhydrolase like 1
Synonyms: Arh2, D330008N11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234072
Homologene: 16311
Tnk2
Name: tyrosine kinase, non-receptor, 2
Synonyms: ACK1, Ack, P21cdc42Hs kinase, Pyk1, activated p21cdc42Hs kinase
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 51789
Homologene: 4224
Prss23
Name: serine protease 23
Synonyms: 2310046G15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76453
Homologene: 5191
Cd151
Name: CD151 antigen
Synonyms: SFA-1, Tspan24, PETA-3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12476
HGNC: HGNC:1630
Homologene: 20916
Vmn1r172
Name: vomeronasal 1 receptor 172
Synonyms: V1rd9, V3R9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 81010
Homologene: 79577
Cdh10
Name: cadherin 10
Synonyms: A830016G23Rik, C030003B10Rik, C030011H18Rik, T2-cadherin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320873
HGNC: HGNC:1749
Homologene: 68530
Vash2
Name: vasohibin 2
Synonyms: B130052G07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226841
Homologene: 57005
Or1a1
Name: olfactory receptor family 1 subfamily A member 1
Synonyms: Olfr403, MOR125-5_p, GA_x6K02T2P1NL-4348188-4349129, IA7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 404316
Homologene: 8219
Slc10a6
Name: solute carrier family 10 (sodium/bile acid cotransporter family), member 6
Synonyms: 8430417G17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75750
Homologene: 12620
Fcamr
Name: Fc receptor, IgA, IgM, high affinity
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 64435
Homologene: 12929
Crb2
Name: crumbs family member 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241324
Homologene: 45474
Pde6g
Name: phosphodiesterase 6G, cGMP-specific, rod, gamma
Synonyms: Pdeg
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18588
HGNC: HGNC:8789
Homologene: 1955
Hoxd3
Name: homeobox D3
Synonyms: Hox-5.5, Hox-4.1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15434
HGNC: HGNC:5137
Homologene: 5034
Btbd18
Name: BTB domain containing 18
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100270744
Homologene: 122125
Prr19
Name: proline rich 19
Synonyms: EG623131
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 623131
Homologene: 85197
Tnfsf10
Name: tumor necrosis factor (ligand) superfamily, member 10
Synonyms: APO-2L, Trail, A330042I21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22035
Homologene: 2824
Or7e171-ps1
Name: olfactory receptor family 7 subfamily E member 171, pseudogene 1
Synonyms: MOR146-11_p, GA_x6K02T2PVTD-13682249-13681321, Olfr863-ps1, MOR146-5P
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258070
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 13,589,608 bp
  • A to T, chromosome 1 at 36,344,127 bp
  • G to A, chromosome 1 at 130,814,023 bp
  • C to T, chromosome 1 at 167,237,642 bp
  • A to T, chromosome 1 at 190,960,299 bp
  • A to G, chromosome 2 at 37,790,199 bp
  • A to G, chromosome 2 at 74,744,219 bp
  • C to T, chromosome 2 at 84,661,543 bp
  • G to C, chromosome 2 at 143,826,875 bp
  • T to A, chromosome 2 at 181,797,240 bp
  • A to T, chromosome 3 at 27,335,348 bp
  • A to G, chromosome 3 at 29,151,920 bp
  • T to C, chromosome 4 at 44,987,255 bp
  • T to A, chromosome 4 at 59,217,109 bp
  • T to A, chromosome 4 at 109,366,242 bp
  • T to C, chromosome 4 at 133,971,130 bp
  • T to C, chromosome 4 at 138,594,312 bp
  • A to G, chromosome 5 at 75,076,104 bp
  • A to T, chromosome 5 at 103,629,126 bp
  • T to C, chromosome 6 at 31,468,168 bp
  • A to T, chromosome 6 at 34,889,115 bp
  • G to T, chromosome 6 at 48,905,411 bp
  • A to G, chromosome 6 at 61,810,880 bp
  • A to T, chromosome 6 at 141,569,463 bp
  • A to C, chromosome 6 at 149,484,093 bp
  • T to A, chromosome 7 at 23,660,416 bp
  • T to C, chromosome 7 at 25,303,918 bp
  • T to A, chromosome 7 at 80,900,703 bp
  • C to T, chromosome 7 at 89,509,764 bp
  • A to G, chromosome 7 at 92,653,245 bp
  • A to T, chromosome 7 at 99,154,636 bp
  • T to A, chromosome 7 at 103,212,654 bp
  • A to G, chromosome 7 at 139,578,380 bp
  • G to A, chromosome 7 at 141,469,589 bp
  • C to T, chromosome 8 at 13,245,534 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • C to T, chromosome 9 at 19,942,231 bp
  • A to T, chromosome 10 at 79,396,617 bp
  • T to A, chromosome 10 at 82,292,997 bp
  • A to G, chromosome 11 at 50,886,367 bp
  • T to C, chromosome 11 at 74,195,586 bp
  • T to C, chromosome 11 at 77,449,650 bp
  • T to G, chromosome 11 at 103,457,509 bp
  • T to A, chromosome 11 at 106,437,123 bp
  • T to C, chromosome 11 at 120,448,124 bp
  • T to C, chromosome 12 at 16,958,421 bp
  • T to A, chromosome 12 at 110,941,476 bp
  • A to T, chromosome 13 at 54,539,704 bp
  • G to A, chromosome 13 at 111,705,249 bp
  • T to A, chromosome 14 at 20,523,651 bp
  • A to G, chromosome 15 at 18,899,694 bp
  • A to C, chromosome 15 at 47,755,992 bp
  • A to T, chromosome 16 at 32,675,520 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7362 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045375-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.