Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7362Btlr/Mmmh
Stock Number:
045375-MU
Citation ID:
RRID:MMRRC_045375-MU
Other Names:
R7362 (G1)
Major Collection:

Strain Information

Inpp5a
Name: inositol polyphosphate-5-phosphatase A
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 212111
HGNC: HGNC:6076
Homologene: 4045
Dgat2
Name: diacylglycerol O-acyltransferase 2
Synonyms: 0610010B06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67800
Homologene: 23580
Wdr73
Name: WD repeat domain 73
Synonyms: 1200011I23Rik, 2410008B13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71968
Homologene: 41899
Pcf11
Name: PCF11 cleavage and polyadenylation factor subunit
Synonyms: 5730417B17Rik, 2500001H09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74737
Homologene: 32282
Uck2
Name: uridine-cytidine kinase 2
Synonyms: TSA903, Umpk
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 80914
Homologene: 40850
Mier3
Name: MIER family member 3
Synonyms: D130064H19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218613
Homologene: 18196
Rock2
Name: Rho-associated coiled-coil containing protein kinase 2
Synonyms: Rock-II, B230113H15Rik, Rho-kinase, ROKalpha, Rock2m
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 19878
VEGA: 12
Homologene: 21010
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 13,589,608 bp
  • A to T, chromosome 1 at 36,344,127 bp
  • G to A, chromosome 1 at 130,814,023 bp
  • C to T, chromosome 1 at 167,237,642 bp
  • A to T, chromosome 1 at 190,960,299 bp
  • A to G, chromosome 2 at 37,790,199 bp
  • A to G, chromosome 2 at 74,744,219 bp
  • C to T, chromosome 2 at 84,661,543 bp
  • G to C, chromosome 2 at 143,826,875 bp
  • T to A, chromosome 2 at 181,797,240 bp
  • A to T, chromosome 3 at 27,335,348 bp
  • A to G, chromosome 3 at 29,151,920 bp
  • T to C, chromosome 4 at 44,987,255 bp
  • T to A, chromosome 4 at 59,217,109 bp
  • T to A, chromosome 4 at 109,366,242 bp
  • T to C, chromosome 4 at 133,971,130 bp
  • T to C, chromosome 4 at 138,594,312 bp
  • A to G, chromosome 5 at 75,076,104 bp
  • A to T, chromosome 5 at 103,629,126 bp
  • T to C, chromosome 6 at 31,468,168 bp
  • A to T, chromosome 6 at 34,889,115 bp
  • G to T, chromosome 6 at 48,905,411 bp
  • A to G, chromosome 6 at 61,810,880 bp
  • A to T, chromosome 6 at 141,569,463 bp
  • A to C, chromosome 6 at 149,484,093 bp
  • T to A, chromosome 7 at 23,660,416 bp
  • T to C, chromosome 7 at 25,303,918 bp
  • T to A, chromosome 7 at 80,900,703 bp
  • C to T, chromosome 7 at 89,509,764 bp
  • A to G, chromosome 7 at 92,653,245 bp
  • A to T, chromosome 7 at 99,154,636 bp
  • T to A, chromosome 7 at 103,212,654 bp
  • A to G, chromosome 7 at 139,578,380 bp
  • G to A, chromosome 7 at 141,469,589 bp
  • C to T, chromosome 8 at 13,245,534 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • C to T, chromosome 9 at 19,942,231 bp
  • A to T, chromosome 10 at 79,396,617 bp
  • T to A, chromosome 10 at 82,292,997 bp
  • A to G, chromosome 11 at 50,886,367 bp
  • T to C, chromosome 11 at 74,195,586 bp
  • T to C, chromosome 11 at 77,449,650 bp
  • T to G, chromosome 11 at 103,457,509 bp
  • T to A, chromosome 11 at 106,437,123 bp
  • T to C, chromosome 11 at 120,448,124 bp
  • T to C, chromosome 12 at 16,958,421 bp
  • T to A, chromosome 12 at 110,941,476 bp
  • A to T, chromosome 13 at 54,539,704 bp
  • G to A, chromosome 13 at 111,705,249 bp
  • T to A, chromosome 14 at 20,523,651 bp
  • A to G, chromosome 15 at 18,899,694 bp
  • A to C, chromosome 15 at 47,755,992 bp
  • A to T, chromosome 16 at 32,675,520 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7362 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045375-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.