Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7405Btlr/Mmmh
Stock Number:
045376-MU
Citation ID:
RRID:MMRRC_045376-MU
Other Names:
R7405 (G1)
Major Collection:

Strain Information

Wrn
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22427
Homologene: 6659
Sez6
Name: seizure related gene 6
Synonyms: sez-6, D11Bhm177e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20370
Homologene: 10948
Mthfd1
Name: methylenetetrahydrofolate dehydrogenase (NADP+ dependent), methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthase
Synonyms: Mthfd, DCS, E430024A07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 108156
VEGA: 12
HGNC: HGNC:7432
Homologene: 55940
Nphs1
Name: nephrosis 1, nephrin
Synonyms: nephrin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54631
HGNC: HGNC:7908
Homologene: 20974
Rbm47
Name: RNA binding motif protein 47
Synonyms: 9530077J19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 245945
Homologene: 36932
Uchl5
Name: ubiquitin carboxyl-terminal esterase L5
Synonyms: Uch37, 5830413B11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56207
Homologene: 9326
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 40,600,926 bp
  • A to T, chromosome 1 at 87,153,516 bp
  • T to A, chromosome 1 at 131,839,146 bp
  • C to T, chromosome 1 at 143,800,014 bp
  • T to C, chromosome 1 at 150,442,127 bp
  • A to G, chromosome 1 at 161,828,214 bp
  • A to G, chromosome 2 at 69,287,619 bp
  • A to T, chromosome 2 at 76,743,346 bp
  • A to C, chromosome 2 at 87,308,995 bp
  • A to G, chromosome 2 at 121,139,387 bp
  • A to G, chromosome 3 at 55,805,266 bp
  • A to T, chromosome 3 at 92,806,874 bp
  • A to G, chromosome 3 at 102,925,227 bp
  • A to G, chromosome 3 at 125,683,216 bp
  • T to C, chromosome 4 at 144,419,753 bp
  • T to C, chromosome 5 at 36,947,142 bp
  • T to A, chromosome 5 at 38,391,824 bp
  • T to C, chromosome 5 at 48,388,116 bp
  • A to T, chromosome 5 at 66,026,495 bp
  • A to T, chromosome 5 at 110,208,446 bp
  • T to C, chromosome 5 at 143,380,444 bp
  • T to C, chromosome 5 at 147,189,133 bp
  • A to T, chromosome 6 at 32,196,319 bp
  • A to G, chromosome 6 at 92,458,543 bp
  • C to A, chromosome 6 at 134,685,982 bp
  • T to C, chromosome 7 at 30,462,828 bp
  • A to T, chromosome 7 at 44,507,194 bp
  • T to C, chromosome 7 at 102,231,388 bp
  • T to A, chromosome 7 at 104,336,483 bp
  • T to C, chromosome 7 at 111,043,714 bp
  • T to A, chromosome 7 at 127,878,796 bp
  • C to T, chromosome 7 at 130,805,856 bp
  • G to A, chromosome 8 at 22,625,843 bp
  • C to G, chromosome 8 at 33,248,966 bp
  • A to T, chromosome 8 at 40,824,622 bp
  • A to T, chromosome 8 at 70,786,171 bp
  • A to G, chromosome 9 at 64,314,704 bp
  • G to A, chromosome 9 at 96,566,027 bp
  • C to T, chromosome 9 at 107,915,122 bp
  • T to C, chromosome 9 at 109,607,068 bp
  • T to C, chromosome 10 at 40,647,997 bp
  • C to A, chromosome 10 at 62,449,784 bp
  • T to C, chromosome 10 at 78,034,613 bp
  • T to C, chromosome 10 at 78,955,697 bp
  • T to C, chromosome 10 at 80,741,900 bp
  • A to G, chromosome 10 at 84,684,179 bp
  • C to T, chromosome 10 at 85,120,496 bp
  • T to A, chromosome 10 at 86,044,581 bp
  • T to C, chromosome 10 at 117,770,415 bp
  • T to C, chromosome 10 at 127,581,751 bp
  • T to C, chromosome 11 at 42,155,023 bp
  • T to A, chromosome 11 at 59,614,073 bp
  • A to T, chromosome 11 at 77,962,891 bp
  • C to T, chromosome 11 at 100,415,881 bp
  • A to T, chromosome 11 at 103,615,161 bp
  • T to A, chromosome 12 at 4,943,232 bp
  • T to C, chromosome 12 at 76,311,874 bp
  • C to T, chromosome 12 at 79,055,047 bp
  • C to T, chromosome 12 at 110,634,220 bp
  • T to C, chromosome 13 at 66,431,059 bp
  • T to A, chromosome 14 at 44,989,074 bp
  • G to A, chromosome 15 at 68,184,485 bp
  • T to A, chromosome 16 at 20,222,913 bp
  • A to G, chromosome 16 at 33,763,449 bp
  • CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC to CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC, chromosome 16 at 91,656,691 bp
  • G to T, chromosome 17 at 9,001,817 bp
  • G to A, chromosome 17 at 28,905,324 bp
  • A to G, chromosome 17 at 32,481,815 bp
  • A to G, chromosome 17 at 35,690,100 bp
  • A to T, chromosome 17 at 54,297,133 bp
  • G to A, chromosome 17 at 56,632,335 bp
  • ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG to ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG, chromosome 18 at 80,089,825 bp
  • T to C, chromosome 19 at 13,654,882 bp
  • T to A, chromosome 19 at 25,410,319 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7405 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045376-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.