Strain Name:
C57BL/6J-MtgxR7405Btlr/Mmmh
Stock Number:
045376-MU
Citation ID:
RRID:MMRRC_045376-MU
Other Names:
R7405 (G1)
Major Collection:

Strain Information

Wrn
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22427
Homologene: 6659
Sez6
Name: seizure related gene 6
Synonyms: sez-6, D11Bhm177e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20370
Homologene: 10948
Mthfd1
Name: methylenetetrahydrofolate dehydrogenase (NADP+ dependent), methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthase
Synonyms: Mthfd, DCS, E430024A07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 108156
VEGA: 12
HGNC: HGNC:7432
Homologene: 55940
Nphs1
Name: nephrosis 1, nephrin
Synonyms: nephrin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54631
HGNC: HGNC:7908
Homologene: 20974
Rbm47
Name: RNA binding motif protein 47
Synonyms: 9530077J19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 245945
Homologene: 36932
Uchl5
Name: ubiquitin carboxyl-terminal esterase L5
Synonyms: Uch37, 5830413B11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56207
Homologene: 9326
Nbea
Name: neurobeachin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 26422
HGNC: HGNC:7648
Homologene: 69190
Zfat
Name: zinc finger and AT hook domain containing
Synonyms: LOC380993, Zfp406, Zfat1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 380993
Homologene: 16829
Yeats2
Name: YEATS domain containing 2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208146
VEGA: 16
Homologene: 9967
Suco
Name: SUN domain containing ossification factor
Synonyms: osteopotentia, Opt, AI848100
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226551
HGNC: HGNC:1240
Homologene: 32212
Tpr
Name: translocated promoter region, nuclear basket protein
Synonyms: 2610029M07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108989
Homologene: 37753
Polr3b
Name: polymerase (RNA) III (DNA directed) polypeptide B
Synonyms: RPC2, 2700078H01Rik, A330032P03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70428
VEGA: 10
Homologene: 6981
Dync1h1
Name: dynein cytoplasmic 1 heavy chain 1
Synonyms: MAP1C, dynein heavy chain, retrograde transport, Dnec1, Loa, 9930018I23Rik, Dnchc1, Swl
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13424
HGNC: HGNC:2961
Homologene: 1053
Nup107
Name: nucleoporin 107
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103468
VEGA: 10
Homologene: 5555
Rasa2
Name: RAS p21 protein activator 2
Synonyms: GAP1m, 5430433H21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 114713
HGNC: HGNC:9872
Homologene: 4745
Borcs5
Name: BLOC-1 related complex subunit 5
Synonyms: 5830457J20Rik, Loh12cr1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67774
Homologene: 12188
Ap3d1
Name: adaptor-related protein complex 3, delta 1 subunit
Synonyms: mBLVR1, Bolvr
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11776
VEGA: 10
HGNC: HGNC:568
Homologene: 2926
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Ctr9
Name: CTR9 homolog, Paf1/RNA polymerase II complex component
Synonyms: Tsp, Tsbp, Sh2bp1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22083
Homologene: 40668
Grid2ip
Name: glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1
Synonyms: delphilin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 170935
Homologene: 15781
Gsx1
Name: GS homeobox 1
Synonyms: Gsh-1, Gsh1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14842
Homologene: 17092
Plxna4
Name: plexin A4
Synonyms: Plxa4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243743
HGNC: HGNC:9102
Homologene: 77587
Ecel1
Name: endothelin converting enzyme-like 1
Synonyms: DINE, XCE
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13599
HGNC: HGNC:3147
Homologene: 3549
Golga3
Name: golgin A3
Synonyms: Mea-2, Mea2, 5430416E01Rik, G1-499-14, repro27
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269682
HGNC: HGNC:4426
Homologene: 4308
Kank1
Name: KN motif and ankyrin repeat domains 1
Synonyms: D330024H06Rik, A930031B09Rik, Ankrd15
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107351
Homologene: 17706
Fbxo7
Name: F-box protein 7
Synonyms: 2410015K21Rik, A230052G17Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 69754
Homologene: 8136
Pgap2
Name: post-GPI attachment to proteins 2
Synonyms: 1810006G21Rik, Frag1, clpex
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233575
Homologene: 137653
Atad2b
Name: ATPase family, AAA domain containing 2B
Synonyms: 1110014E10Rik, D530031C13Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320817
VEGA: 12
Homologene: 86351
Slc9a4
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 4
Synonyms: NHE4, D730009J23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 110895
Homologene: 72232
Zfp998
Name: zinc finger protein 998
Synonyms: Gt(pU21)35Imeg, Gt(Ayu21)35Imeg, 2410141K09Rik, Snerv1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76803
Homologene: 136362
Mst1r
Name: macrophage stimulating 1 receptor (c-met-related tyrosine kinase)
Synonyms: STK, Fv-2, Ron, CDw136, friend virus susceptibility 2, PTK8, Fv2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19882
HGNC: HGNC:7381
Homologene: 1835
Ddr1
Name: discoidin domain receptor family, member 1
Synonyms: CD167a, Cak
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12305
HGNC: HGNC:2730
Homologene: 68212
Ptger2
Name: prostaglandin E receptor 2 (subtype EP2)
Synonyms: EP2, Ptgerep2, EP2 receptor
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19217
HGNC: HGNC:9594
Homologene: 739
Btbd16
Name: BTB domain containing 16
Synonyms: E330040A16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330660
Homologene: 77327
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Lrp1
Name: low density lipoprotein receptor-related protein 1
Synonyms: CD91, A2mr, b2b1554Clo
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16971
HGNC: HGNC:6692
Homologene: 1744
Ndst4
Name: N-deacetylase/N-sulfotransferase (heparin glucosaminyl) 4
Synonyms: 4930439H17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 64580
Homologene: 11208
Zfp646
Name: zinc finger protein 646
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233905
Homologene: 8802
1700010I14Rik
Name: RIKEN cDNA 1700010I14 gene
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66931
Homologene: 49841
Sycp1
Name: synaptonemal complex protein 1
Synonyms: SCP1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20957
Homologene: 2389
Abcb11
Name: ATP-binding cassette, sub-family B member 11
Synonyms: PFIC2, ABC16, PGY4, Lith1, sister of P-glycoprotein, Bsep
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27413
HGNC: HGNC:42
Homologene: 74509
Trim34b
Name: tripartite motif-containing 34B
Synonyms: Trim34-2, Gm15134
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434218
Homologene: 128238
Ppp2r2c
Name: protein phosphatase 2, regulatory subunit B, gamma
Synonyms: IMYPNO1, PR52, 6330548O06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269643
HGNC: HGNC:9306
Homologene: 36386
Mast3
Name: microtubule associated serine/threonine kinase 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 546071
Homologene: 66191
Lrrc37
Name: leucine rich repeat containing 37
Synonyms: LOC380730, Gm884
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380730
Homologene: 134511
Dis3l
Name: DIS3 like exosome 3'-5' exoribonuclease
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 213550
Homologene: 15797
Or10w1
Name: olfactory receptor family 10 subfamily W member 1
Synonyms: GA_x6K02T2RE5P-3987000-3987950, MOR266-6P, Olfr1490
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258098
Homologene: 79418
Adam39
Name: a disintegrin and metallopeptidase domain 39
Synonyms: 1700056P18Rik, testase 9
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 546055
HGNC: HGNC:199
Homologene: 128364
Plekhh1
Name: pleckstrin homology domain containing, family H (with MyTH4 domain) member 1
Synonyms: D630024D12Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 211945
VEGA: 12
Homologene: 121939
Heg1
Name: heart development protein with EGF-like domains 1
Synonyms: LOC268884, 5530401I02Rik, 9530025L16Rik, 4632417D23Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 77446
Homologene: 35276
Mybpc2
Name: myosin binding protein C, fast-type
Synonyms: Fast-type C-protein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233199
HGNC: HGNC:7550
Homologene: 3331
Slc2a9
Name: solute carrier family 2 (facilitated glucose transporter), member 9
Synonyms: Glut9, SLC2A9B, SLC2a9A
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 117591
Homologene: 69290
Prickle2
Name: prickle planar cell polarity protein 2
Synonyms: 6720451F06Rik, 6230400G14Rik, mpk2, Pk2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243548
Homologene: 17889
Fbxw24
Name: F-box and WD-40 domain protein 24
Synonyms: Gm5162
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382106
Homologene: 110776
Cyp4f39
Name: cytochrome P450, family 4, subfamily f, polypeptide 39
Synonyms: 4732474A20Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320997
VEGA: 17
Homologene: 69814
Or2w25
Name: olfactory receptor family 2 subfamily W member 25
Synonyms: GA_x6K02T0073K-490-1545, MOR256-51, Olfr225
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 257886
Homologene: 105324
Slc41a1
Name: solute carrier family 41, member 1
Synonyms: B230315F01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98396
Homologene: 14871
Slc5a7
Name: solute carrier family 5 (choline transporter), member 7
Synonyms: CHT1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 63993
VEGA: 17
Homologene: 32516
Lcmt2
Name: leucine carboxyl methyltransferase 2
Synonyms: Tyw4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329504
Homologene: 19642
Catsperd
Name: cation channel sperm associated auxiliary subunit delta
Synonyms: 4933402B14Rik, Gm6095, 4921529N20Rik, Tmem146
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106757
VEGA: 17
Homologene: 51896
Or10ag56
Name: olfactory receptor family 10 subfamily AG member 56
Synonyms: GA_x6K02T2Q125-48795705-48796673, MOR264-22, Olfr1118-ps, Olfr1118
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 404328
Homologene: 134077
Fkbp10
Name: FK506 binding protein 10
Synonyms: FKBP65, Fkbp1-rs, Fkbp-rs1, Fkbp6, 65kDa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14230
Homologene: 7718
Dkk4
Name: dickkopf WNT signaling pathway inhibitor 4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234130
HGNC: HGNC:2894
Homologene: 8680
Gabra1
Name: gamma-aminobutyric acid type A receptor subunit alpha 1
Synonyms: GABAA alpha 1, Gabra-1, GABAAR alpha1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14394
HGNC: HGNC:4075
Homologene: 629
Cfap107
Name: cilia and flagella associated protein 107
Synonyms: 1700012P22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69364
Homologene: 17541
Mterf2
Name: mitochondrial transcription termination factor 2
Synonyms: 1700007D05Rik, Mterfd3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74238
VEGA: 10
Homologene: 11869
Or7a42
Name: olfactory receptor family 7 subfamily A member 42
Synonyms: MOR139-5P, GA_x6K02T2QGN0-2857086-2856154, Olfr8
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18372
Homologene: 136441
Ddo
Name: D-aspartate oxidase
Synonyms: 5730402C02Rik, 5330420D20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70503
VEGA: 10
HGNC: HGNC:2727
Homologene: 101531
Bnip5
Name: BCL2 interacting protein 5
Synonyms: 4930539E08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 207819
Homologene: 52098
Lce1k
Name: late cornified envelope 1K
Synonyms: Sprrl6, Gm7055
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 631101
4930507D05Rik
Name: RIKEN cDNA 4930507D05 gene
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74706
VEGA: 10
Gm21886
Name: predicted gene, 21886
Type: Gene
Species: Mouse
Chromosome: 18
5730480H06Rik
Name: RIKEN cDNA 5730480H06 gene
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70592
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 40,600,926 bp
  • A to T, chromosome 1 at 87,153,516 bp
  • T to A, chromosome 1 at 131,839,146 bp
  • C to T, chromosome 1 at 143,800,014 bp
  • T to C, chromosome 1 at 150,442,127 bp
  • A to G, chromosome 1 at 161,828,214 bp
  • A to G, chromosome 2 at 69,287,619 bp
  • A to T, chromosome 2 at 76,743,346 bp
  • A to C, chromosome 2 at 87,308,995 bp
  • A to G, chromosome 2 at 121,139,387 bp
  • A to G, chromosome 3 at 55,805,266 bp
  • A to T, chromosome 3 at 92,806,874 bp
  • A to G, chromosome 3 at 102,925,227 bp
  • A to G, chromosome 3 at 125,683,216 bp
  • T to C, chromosome 4 at 144,419,753 bp
  • T to C, chromosome 5 at 36,947,142 bp
  • T to A, chromosome 5 at 38,391,824 bp
  • T to C, chromosome 5 at 48,388,116 bp
  • A to T, chromosome 5 at 66,026,495 bp
  • A to T, chromosome 5 at 110,208,446 bp
  • T to C, chromosome 5 at 143,380,444 bp
  • T to C, chromosome 5 at 147,189,133 bp
  • A to T, chromosome 6 at 32,196,319 bp
  • A to G, chromosome 6 at 92,458,543 bp
  • C to A, chromosome 6 at 134,685,982 bp
  • T to C, chromosome 7 at 30,462,828 bp
  • A to T, chromosome 7 at 44,507,194 bp
  • T to C, chromosome 7 at 102,231,388 bp
  • T to A, chromosome 7 at 104,336,483 bp
  • T to C, chromosome 7 at 111,043,714 bp
  • T to A, chromosome 7 at 127,878,796 bp
  • C to T, chromosome 7 at 130,805,856 bp
  • G to A, chromosome 8 at 22,625,843 bp
  • C to G, chromosome 8 at 33,248,966 bp
  • A to T, chromosome 8 at 40,824,622 bp
  • A to T, chromosome 8 at 70,786,171 bp
  • A to G, chromosome 9 at 64,314,704 bp
  • G to A, chromosome 9 at 96,566,027 bp
  • C to T, chromosome 9 at 107,915,122 bp
  • T to C, chromosome 9 at 109,607,068 bp
  • T to C, chromosome 10 at 40,647,997 bp
  • C to A, chromosome 10 at 62,449,784 bp
  • T to C, chromosome 10 at 78,034,613 bp
  • T to C, chromosome 10 at 78,955,697 bp
  • T to C, chromosome 10 at 80,741,900 bp
  • A to G, chromosome 10 at 84,684,179 bp
  • C to T, chromosome 10 at 85,120,496 bp
  • T to A, chromosome 10 at 86,044,581 bp
  • T to C, chromosome 10 at 117,770,415 bp
  • T to C, chromosome 10 at 127,581,751 bp
  • T to C, chromosome 11 at 42,155,023 bp
  • T to A, chromosome 11 at 59,614,073 bp
  • A to T, chromosome 11 at 77,962,891 bp
  • C to T, chromosome 11 at 100,415,881 bp
  • A to T, chromosome 11 at 103,615,161 bp
  • T to A, chromosome 12 at 4,943,232 bp
  • T to C, chromosome 12 at 76,311,874 bp
  • C to T, chromosome 12 at 79,055,047 bp
  • C to T, chromosome 12 at 110,634,220 bp
  • T to C, chromosome 13 at 66,431,059 bp
  • T to A, chromosome 14 at 44,989,074 bp
  • G to A, chromosome 15 at 68,184,485 bp
  • T to A, chromosome 16 at 20,222,913 bp
  • A to G, chromosome 16 at 33,763,449 bp
  • CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC to CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC, chromosome 16 at 91,656,691 bp
  • G to T, chromosome 17 at 9,001,817 bp
  • G to A, chromosome 17 at 28,905,324 bp
  • A to G, chromosome 17 at 32,481,815 bp
  • A to G, chromosome 17 at 35,690,100 bp
  • A to T, chromosome 17 at 54,297,133 bp
  • G to A, chromosome 17 at 56,632,335 bp
  • ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG to ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG, chromosome 18 at 80,089,825 bp
  • T to C, chromosome 19 at 13,654,882 bp
  • T to A, chromosome 19 at 25,410,319 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7405 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045376-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.