Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7292Btlr/Mmmh
Stock Number:
045397-MU
Citation ID:
RRID:MMRRC_045397-MU
Other Names:
R7292 (G1)
Major Collection:

Strain Information

Tk1
Name: thymidine kinase 1
Synonyms: Tk-1, D530002A18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21877
Homologene: 37749
Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Meis1
Name: Meis homeobox 1
Synonyms: C530044H18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17268
HGNC: HGNC:7000
Homologene: 86803
Slc1a6
Name: solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6
Synonyms: EAAT4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20513
VEGA: 10
Homologene: 21055
Gnl3
Name: guanine nucleotide binding protein nucleolar 3
Synonyms: nucleostemin, NS
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 30877
VEGA: 14
Homologene: 56670
Rbm47
Name: RNA binding motif protein 47
Synonyms: 9530077J19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 245945
Homologene: 36932
Abcc8
Name: ATP-binding cassette, sub-family C member 8
Synonyms: SUR1, Sur, D930031B21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20927
HGNC: HGNC:59
Homologene: 68048
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 24,530,008 bp
  • A to G, chromosome 1 at 25,531,876 bp
  • C to T, chromosome 1 at 59,143,810 bp
  • A to C, chromosome 1 at 91,196,777 bp
  • G to T, chromosome 1 at 105,721,416 bp
  • C to A, chromosome 1 at 125,572,485 bp
  • T to C, chromosome 1 at 150,733,129 bp
  • G to T, chromosome 1 at 172,491,757 bp
  • A to G, chromosome 1 at 173,473,862 bp
  • T to A, chromosome 1 at 173,595,125 bp
  • G to A, chromosome 1 at 189,650,694 bp
  • C to T, chromosome 2 at 13,170,016 bp
  • G to T, chromosome 2 at 13,424,739 bp
  • TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC to TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC, chromosome 2 at 28,466,110 bp
  • T to C, chromosome 2 at 31,643,850 bp
  • A to G, chromosome 2 at 118,693,591 bp
  • T to A, chromosome 2 at 122,742,695 bp
  • C to T, chromosome 2 at 131,191,173 bp
  • A to T, chromosome 4 at 52,611,630 bp
  • T to C, chromosome 4 at 58,111,395 bp
  • G to A, chromosome 4 at 88,868,331 bp
  • G to A, chromosome 4 at 143,132,901 bp
  • T to A, chromosome 5 at 66,026,750 bp
  • C to A, chromosome 5 at 114,258,655 bp
  • A to G, chromosome 5 at 122,880,791 bp
  • T to C, chromosome 5 at 139,150,317 bp
  • A to G, chromosome 5 at 140,471,670 bp
  • A to T, chromosome 6 at 69,059,768 bp
  • C to T, chromosome 6 at 88,090,084 bp
  • G to A, chromosome 6 at 116,551,477 bp
  • G to T, chromosome 6 at 146,158,949 bp
  • A to T, chromosome 7 at 19,036,030 bp
  • G to T, chromosome 7 at 24,778,350 bp
  • G to A, chromosome 7 at 46,135,526 bp
  • T to A, chromosome 7 at 64,372,486 bp
  • G to A, chromosome 7 at 143,701,278 bp
  • A to G, chromosome 8 at 40,382,125 bp
  • T to C, chromosome 8 at 54,526,519 bp
  • A to G, chromosome 8 at 110,881,828 bp
  • T to C, chromosome 8 at 113,709,645 bp
  • A to T, chromosome 9 at 18,816,190 bp
  • T to C, chromosome 9 at 49,061,191 bp
  • A to G, chromosome 9 at 67,346,461 bp
  • T to C, chromosome 9 at 101,212,672 bp
  • A to C, chromosome 9 at 111,377,870 bp
  • C to T, chromosome 10 at 59,071,973 bp
  • A to G, chromosome 10 at 78,814,604 bp
  • A to G, chromosome 11 at 19,011,351 bp
  • G to T, chromosome 11 at 115,786,256 bp
  • C to T, chromosome 11 at 117,825,777 bp
  • A to G, chromosome 13 at 27,807,370 bp
  • T to A, chromosome 13 at 65,152,842 bp
  • A to G, chromosome 14 at 31,013,232 bp
  • A to G, chromosome 14 at 44,336,557 bp
  • G to A, chromosome 14 at 55,825,055 bp
  • A to T, chromosome 14 at 56,262,119 bp
  • G to T, chromosome 14 at 67,677,877 bp
  • T to A, chromosome 15 at 27,828,351 bp
  • T to A, chromosome 15 at 44,498,590 bp
  • T to C, chromosome 16 at 32,680,800 bp
  • T to A, chromosome 17 at 8,997,029 bp
  • G to C, chromosome 17 at 20,541,438 bp
  • G to A, chromosome 17 at 34,051,508 bp
  • T to C, chromosome 17 at 78,605,498 bp
  • G to A, chromosome 18 at 35,654,550 bp
  • A to T, chromosome 19 at 58,789,107 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7292 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045397-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.