Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7292Btlr/Mmmh
Stock Number:
045397-MU
Citation ID:
RRID:MMRRC_045397-MU
Other Names:
R7292 (G1)
Major Collection:

Strain Information

Tk1
Name: thymidine kinase 1
Synonyms: Tk-1, D530002A18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21877
Homologene: 37749
Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Meis1
Name: Meis homeobox 1
Synonyms: C530044H18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17268
HGNC: HGNC:7000
Homologene: 86803
Slc1a6
Name: solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6
Synonyms: EAAT4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20513
VEGA: 10
Homologene: 21055
Gnl3
Name: guanine nucleotide binding protein nucleolar 3
Synonyms: nucleostemin, NS
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 30877
VEGA: 14
Homologene: 56670
Rbm47
Name: RNA binding motif protein 47
Synonyms: 9530077J19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 245945
Homologene: 36932
Abcc8
Name: ATP-binding cassette, sub-family C member 8
Synonyms: SUR1, Sur, D930031B21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20927
HGNC: HGNC:59
Homologene: 68048
Prdm2
Name: PR domain containing 2, with ZNF domain
Synonyms: Riz, Riz1, LOC381568, E330024L24Rik, 4833427P12Rik, KMT8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 110593
HGNC: HGNC:9347
Homologene: 40822
Cdca2
Name: cell division cycle associated 2
Synonyms: 2610311M19Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 108912
Homologene: 18444
Kdm2b
Name: lysine (K)-specific demethylase 2B
Synonyms: Cxxc2, Jhdm1b, Fbxl10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 30841
Homologene: 13069
Relch
Name: RAB11 binding and LisH domain, coiled-coil and HEAT repeat containing
Synonyms: 2310035C23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227446
Homologene: 10834
Cog4
Name: component of oligomeric golgi complex 4
Synonyms: D8Ertd515e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102339
Homologene: 7155
Cenpf
Name: centromere protein F
Synonyms: 6530404A22Rik, Lek1, mitosin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108000
HGNC: HGNC:1857
Homologene: 22969
Trio
Name: triple functional domain (PTPRF interacting)
Synonyms: 6720464I07Rik, Solo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223435
VEGA: 15
Homologene: 20847
Bloc1s6
Name: biogenesis of lysosomal organelles complex-1, subunit 6, pallidin
Synonyms: BLOC-1 subunit, BLOC-1, Pldn
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18457
HGNC: HGNC:8549
Homologene: 40841
Dnaaf5
Name: dynein, axonemal assembly factor 5
Synonyms: Heatr2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 433956
Homologene: 41198
Micu3
Name: mitochondrial calcium uptake family, member 3
Synonyms: 2900075B16Rik, Efha2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 78506
Homologene: 15058
Fan1
Name: FANCD2/FANCI-associated nuclease 1
Synonyms: 6030441H18Rik, Mtmr15
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330554
Homologene: 45598
Igsf9
Name: immunoglobulin superfamily, member 9
Synonyms: NRT1, Dasm1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 93842
Homologene: 10815
Rpn1
Name: ribophorin I
Synonyms: Rpn-1, D6Wsu137e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 103963
Homologene: 2213
Rsu1
Name: Ras suppressor protein 1
Synonyms: rsp-1, RsuI
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20163
Homologene: 7521
Sympk
Name: symplekin
Synonyms: 4632415H16Rik, 1500016F02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68188
Homologene: 37969
Spcs3
Name: signal peptidase complex subunit 3 homolog (S. cerevisiae)
Synonyms: 1810011E08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76687
Homologene: 41454
Slc35f5
Name: solute carrier family 35, member F5
Synonyms: 1300003P13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74150
Homologene: 5745
Vit
Name: vitrin
Synonyms: 1700110E08Rik, 1700052E02Rik, 2810429K11Rik, AKH, akhirin
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74199
VEGA: 17
Homologene: 24942
Pak6
Name: p21 (RAC1) activated kinase 6
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214230
Homologene: 23200
Ramp1
Name: receptor (calcitonin) activity modifying protein 1
Synonyms: 9130218E19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 51801
HGNC: HGNC:9843
Homologene: 4275
Cubn
Name: cubilin
Synonyms: D2Wsu88e, intrinsic factor-cobalamin receptor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65969
HGNC: HGNC:2548
Homologene: 37434
Pierce1
Name: piercer of microtubule wall 1
Synonyms: 1700007K13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69327
Homologene: 35416
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Itpr2
Name: inositol 1,4,5-triphosphate receptor 2
Synonyms: Ip3r2, Itpr5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16439
HGNC: HGNC:6181
Homologene: 37593
Svep1
Name: sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Synonyms: 4833413O10Rik, D430029O09Rik, 1110021D17Rik, Polydom
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 64817
Homologene: 23386
Col11a2
Name: collagen, type XI, alpha 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12815
HGNC: HGNC:2187
Homologene: 22547
Spmip5
Name: sperm microtubule inner protein 5
Synonyms: 1700019N19Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 67507
Homologene: 12147
Adgrb3
Name: adhesion G protein-coupled receptor B3
Synonyms: A830096D10Rik, Bai3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210933
HGNC: HGNC:945
Homologene: 1289
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: D86 mRNA, PKHDL1, fibrocystin L
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 192190
Homologene: 16332
Trank1
Name: tetratricopeptide repeat and ankyrin repeat containing 1
Synonyms: A230061D21Rik, LOC235639, C030048J01Rik, Lba1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320429
Homologene: 45845
Col19a1
Name: collagen, type XIX, alpha 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12823
HGNC: HGNC:2196
Homologene: 55608
Ceacam10
Name: CEA cell adhesion molecule 10
Synonyms: Bgp3, Cea10
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26366
HGNC: HGNC:1816
Ifi206
Name: interferon activated gene 206
Synonyms: Gm4955, Pyblhin-C
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 102639543
Homologene: 115929
Tmem94
Name: transmembrane protein 94
Synonyms: 2310067B10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71947
Homologene: 8831
Adamts18
Name: ADAM metallopeptidase with thrombospondin type 1 motif 18
Synonyms: E130314N14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 208936
Homologene: 65241
4930553M12Rik
Name: RIKEN cDNA 4930553M12 gene
Type: Gene
Species: Mouse
Chromosome: 4
Osbpl5
Name: oxysterol binding protein-like 5
Synonyms: Obph1, ORP5, 1110006M06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 79196
Homologene: 98024
Ppp2r3a
Name: protein phosphatase 2, regulatory subunit B'', alpha
Synonyms: 3222402P14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235542
HGNC: HGNC:9307
Homologene: 20595
Prob1
Name: proline rich basic protein 1
Synonyms: LOC381148, Gm1614
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 381148
Homologene: 83773
Or9s18
Name: olfactory receptor family 9 subfamily S member 18
Synonyms: GA_x6K02T2PB7A-3051266-3052192, MOR209-1, Olfr466
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 258816
Homologene: 72032
Tnk2
Name: tyrosine kinase, non-receptor, 2
Synonyms: P21cdc42Hs kinase, Ack, activated p21cdc42Hs kinase, ACK1, Pyk1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 51789
Homologene: 4224
Or7g16
Name: olfactory receptor family 7 subfamily G member 16
Synonyms: GA_x6K02T2PVTD-12559294-12558356, MOR149-1, Olfr828
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258598
HGNC: HGNC:8466
Homologene: 133690
Vmn2r109
Name: vomeronasal 2, receptor 109
Synonyms: EG627814
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627814
Homologene: 129678
Mpp4
Name: membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)
Synonyms: DLG6
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227157
Homologene: 23296
Zw10
Name: zw10 kinetochore protein
Synonyms: MmZw10, 6330566F14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 26951
VEGA: 9
Homologene: 37959
Sh3rf3
Name: SH3 domain containing ring finger 3
Synonyms: 4831416G18Rik, Sh3md4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237353
Homologene: 77551
Nfatc4
Name: nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 4
Synonyms: 3110041H08Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 73181
VEGA: 14
HGNC: HGNC:7778
Homologene: 3349
Toporsl
Name: topoisomerase I binding, arginine/serine-rich like
Synonyms: 4930547C10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68274
Homologene: 130753
Prdm12
Name: PR domain containing 12
Synonyms: LOC381359
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381359
Homologene: 10999
Ifi213
Name: interferon activated gene 213
Synonyms: E030037K03Rik, Pydc4, Pyr-A
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 623121
Homologene: 115929
Prl2a1
Name: prolactin family 2, subfamily a, member 1
Synonyms: PLP-M, Prlpm
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56635
Homologene: 10556
Gzmb
Name: granzyme B
Synonyms: CCP1, CCP-1/C11, Ctla-1, Ctla1, GZB
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14939
VEGA: 14
HGNC: HGNC:4709
Igkv4-78
Name: immunoglobulin kappa variable 4-78
Synonyms: Igkv4-78 immunoglobulin light chain variable region
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 545849
Kif19b
Name: kinesin family member 19B
Synonyms: Gm4869
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 101055939
Homologene: 82478
Eif4a3l2
Name: eukaryotic translation initiation factor 4A3 like 2
Synonyms: Gm5580
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 434080
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 24,530,008 bp
  • A to G, chromosome 1 at 25,531,876 bp
  • C to T, chromosome 1 at 59,143,810 bp
  • A to C, chromosome 1 at 91,196,777 bp
  • G to T, chromosome 1 at 105,721,416 bp
  • C to A, chromosome 1 at 125,572,485 bp
  • T to C, chromosome 1 at 150,733,129 bp
  • G to T, chromosome 1 at 172,491,757 bp
  • A to G, chromosome 1 at 173,473,862 bp
  • T to A, chromosome 1 at 173,595,125 bp
  • G to A, chromosome 1 at 189,650,694 bp
  • C to T, chromosome 2 at 13,170,016 bp
  • G to T, chromosome 2 at 13,424,739 bp
  • TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC to TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC, chromosome 2 at 28,466,110 bp
  • T to C, chromosome 2 at 31,643,850 bp
  • A to G, chromosome 2 at 118,693,591 bp
  • T to A, chromosome 2 at 122,742,695 bp
  • C to T, chromosome 2 at 131,191,173 bp
  • A to T, chromosome 4 at 52,611,630 bp
  • T to C, chromosome 4 at 58,111,395 bp
  • G to A, chromosome 4 at 88,868,331 bp
  • G to A, chromosome 4 at 143,132,901 bp
  • T to A, chromosome 5 at 66,026,750 bp
  • C to A, chromosome 5 at 114,258,655 bp
  • A to G, chromosome 5 at 122,880,791 bp
  • T to C, chromosome 5 at 139,150,317 bp
  • A to G, chromosome 5 at 140,471,670 bp
  • A to T, chromosome 6 at 69,059,768 bp
  • C to T, chromosome 6 at 88,090,084 bp
  • G to A, chromosome 6 at 116,551,477 bp
  • G to T, chromosome 6 at 146,158,949 bp
  • A to T, chromosome 7 at 19,036,030 bp
  • G to T, chromosome 7 at 24,778,350 bp
  • G to A, chromosome 7 at 46,135,526 bp
  • T to A, chromosome 7 at 64,372,486 bp
  • G to A, chromosome 7 at 143,701,278 bp
  • A to G, chromosome 8 at 40,382,125 bp
  • T to C, chromosome 8 at 54,526,519 bp
  • A to G, chromosome 8 at 110,881,828 bp
  • T to C, chromosome 8 at 113,709,645 bp
  • A to T, chromosome 9 at 18,816,190 bp
  • T to C, chromosome 9 at 49,061,191 bp
  • A to G, chromosome 9 at 67,346,461 bp
  • T to C, chromosome 9 at 101,212,672 bp
  • A to C, chromosome 9 at 111,377,870 bp
  • C to T, chromosome 10 at 59,071,973 bp
  • A to G, chromosome 10 at 78,814,604 bp
  • A to G, chromosome 11 at 19,011,351 bp
  • G to T, chromosome 11 at 115,786,256 bp
  • C to T, chromosome 11 at 117,825,777 bp
  • A to G, chromosome 13 at 27,807,370 bp
  • T to A, chromosome 13 at 65,152,842 bp
  • A to G, chromosome 14 at 31,013,232 bp
  • A to G, chromosome 14 at 44,336,557 bp
  • G to A, chromosome 14 at 55,825,055 bp
  • A to T, chromosome 14 at 56,262,119 bp
  • G to T, chromosome 14 at 67,677,877 bp
  • T to A, chromosome 15 at 27,828,351 bp
  • T to A, chromosome 15 at 44,498,590 bp
  • T to C, chromosome 16 at 32,680,800 bp
  • T to A, chromosome 17 at 8,997,029 bp
  • G to C, chromosome 17 at 20,541,438 bp
  • G to A, chromosome 17 at 34,051,508 bp
  • T to C, chromosome 17 at 78,605,498 bp
  • G to A, chromosome 18 at 35,654,550 bp
  • A to T, chromosome 19 at 58,789,107 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7292 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045397-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.