Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7300Btlr/Mmmh
Stock Number:
045404-MU
Citation ID:
RRID:MMRRC_045404-MU
Other Names:
R7300 (G1)
Major Collection:

Strain Information

Sim1
Name: single-minded family bHLH transcription factor 1
Synonyms: bHLHe14
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20464
VEGA: 10
Homologene: 3715
Rarg
Name: retinoic acid receptor, gamma
Synonyms: RARgamma2, RAR gamma 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 19411
HGNC: HGNC:9866
Homologene: 20263
Map3k8
Name: mitogen-activated protein kinase kinase kinase 8
Synonyms: Cot, Tpl2, c-COT, Tpl-2, Cot/Tpl2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 26410
HGNC: HGNC:6860
Homologene: 3812
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Pdxdc1
Name: pyridoxal-dependent decarboxylase domain containing 1
Synonyms: 2210010A19Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 94184
Homologene: 22858
Ttc17
Name: tetratricopeptide repeat domain 17
Synonyms: D2Bwg1005e, 9130020K17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74569
Homologene: 10100
Atr
Name: ataxia telangiectasia and Rad3 related
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245000
HGNC: HGNC:882
Homologene: 96916
Ubac2
Name: ubiquitin associated domain containing 2
Synonyms: 1190008A14Rik, Phgdhl1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68889
VEGA: 14
Homologene: 18642
Cip2a
Name: cell proliferation regulating inhibitor of protein phosphatase 2A
Synonyms: Cip2a, C330027C09Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224171
Homologene: 10842
Zzef1
Name: zinc finger, ZZ-type with EF hand domain 1
Synonyms: 8430405D05Rik, C130099L13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 195018
Homologene: 9027
Ccdc141
Name: coiled-coil domain containing 141
Synonyms: ENSMUSG00000075261, CAMDI, 2610301F02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 545428
Homologene: 52149
Cd63
Name: CD63 antigen
Synonyms: ME491, Tspan30
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12512
VEGA: 10
HGNC: HGNC:1692
Homologene: 37526
Il2ra
Name: interleukin 2 receptor, alpha chain
Synonyms: IL-2R alpha chain, CD25, Ly-43, Il2r
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16184
HGNC: HGNC:6008
Homologene: 360
Homer3
Name: homer scaffolding protein 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 26558
Homologene: 37972
Col4a4
Name: collagen, type IV, alpha 4
Synonyms: [a]4(IV), E130010M05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12829
HGNC: HGNC:2206
Homologene: 20071
Actmap
Name: actin maturation protease
Synonyms: BC024978
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 414069
Homologene: 45689
Pde4a
Name: phosphodiesterase 4A, cAMP specific
Synonyms: dunce, Dpde2, D9Ertd60e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18577
HGNC: HGNC:8780
Homologene: 4520
Dnah1
Name: dynein, axonemal, heavy chain 1
Synonyms: MDHC7, E030034C22Rik, B230373P09Rik, Dnahc1, G1-415-19, ferf1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110084
VEGA: 14
HGNC: HGNC:2940
Homologene: 67131
Ryr1
Name: ryanodine receptor 1, skeletal muscle
Synonyms: calcium release channel isoform 1, Ryr, skrr
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20190
Homologene: 68069
Adgrd1
Name: adhesion G protein-coupled receptor D1
Synonyms: E230012M21Rik, Gpr133
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243277
Homologene: 34616
Pou4f2
Name: POU domain, class 4, transcription factor 2
Synonyms: Brn-3.2, Brn-3b, mBrn3-3R, Brn3b, Pou4f-rs1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18997
HGNC: HGNC:9219
Homologene: 20959
Pla2g4e
Name: phospholipase A2, group IVE
Synonyms: 2310026J01Rik, Pla2epsilon
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329502
Homologene: 65339
Bpifb5
Name: BPI fold containing family B, member 5
Synonyms: BC018465
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228802
Homologene: 64814
Il17ra
Name: interleukin 17 receptor A
Synonyms: VDw217, Il17r
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16172
HGNC: HGNC:5985
Homologene: 7378
Spag4
Name: sperm associated antigen 4
Synonyms: 1700041K21Rik, Sun4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 245865
Homologene: 2343
Olfml3
Name: olfactomedin-like 3
Synonyms: HNOEL-iso, 2810002E22Rik, mONT3, ONT3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99543
Homologene: 10613
Or7g17
Name: olfactory receptor family 7 subfamily G member 17
Synonyms: GA_x6K02T2PVTD-12599710-12600648, MOR147-1, Olfr829
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 259070
HGNC: HGNC:8466
Homologene: 138324
Phldb2
Name: pleckstrin homology like domain, family B, member 2
Synonyms: LL5beta, LL5b, C820004H04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208177
Homologene: 17100
Large1
Name: LARGE xylosyl- and glucuronyltransferase 1
Synonyms: fg, BPFD#36, froggy, enr
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16795
HGNC: HGNC:6511
Homologene: 7810
Or52i2
Name: olfactory receptor family 52 subfamily J member 2
Synonyms: GA_x6K02T2PBJ9-5386601-5387575, MOR41-1, Olfr556
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258749
Homologene: 17380
Btbd2
Name: BTB domain containing 2
Synonyms: 2610037C03Rik, 4930512K17Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 208198
Homologene: 32365
Or2n1c
Name: olfactory receptor family 2 subfamily N member 1C
Synonyms: MOR256-48, GA_x6K02T2PSCP-2656648-2657586, Olfr135
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258329
Homologene: 110603
Serpinb8
Name: serine (or cysteine) peptidase inhibitor, clade B, member 8
Synonyms: ovalbumin, CAP-2, CAP2, Spi8, NK10
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20725
HGNC: HGNC:8952
Homologene: 74445
Zswim5
Name: zinc finger SWIM-type containing 5
Synonyms: 4933426E21Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74464
Homologene: 18958
Or8k25
Name: olfactory receptor family 8 subfamily K member 25
Synonyms: GA_x6K02T2Q125-47883395-47882454, MOR188-1, MOR188-9, MOR188-1, MOR188-7, Olfr1515, Olfr1061
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259022
Homologene: 79468
Itgb6
Name: integrin beta 6
Synonyms: 4831415H04Rik, 2210409C20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16420
HGNC: HGNC:6161
Homologene: 685
Krt31
Name: keratin 31
Synonyms: Ha1, Kha1, MKHA-1, Krt1-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16660
Homologene: 74433
Cyp4a31
Name: cytochrome P450, family 4, subfamily a, polypeptide 31
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 666168
Homologene: 128044
Or13a27
Name: olfactory receptor family 13 subfamily A member 27
Synonyms: IH6, MOR253-6, GA_x6K02T2PBJ9-42496183-42495251, Olfr60
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18361
Homologene: 34961
Mstn
Name: myostatin
Synonyms: Gdf8
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17700
HGNC: HGNC:4223
Homologene: 3850
Ppl
Name: periplakin
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19041
VEGA: 16
HGNC: HGNC:9273
Homologene: 2026
Or2y1c
Name: olfactory receptor family 2 subfamily Y member 1C
Synonyms: GA_x6K02T2QP88-5964781-5963852, MOR256-50, Olfr1386
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 257888
Homologene: 86692
Vmn2r31
Name: vomeronasal 2, receptor 31
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100042591
Homologene: 113703
Fpgt
Name: fucose-1-phosphate guanylyltransferase
Synonyms: 1700016E03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75540
HGNC: HGNC:3825
Homologene: 2847
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 53,064,080 bp
  • C to T, chromosome 1 at 82,486,640 bp
  • T to A, chromosome 1 at 107,607,323 bp
  • A to G, chromosome 2 at 11,676,910 bp
  • T to C, chromosome 2 at 60,605,306 bp
  • G to A, chromosome 2 at 77,014,694 bp
  • T to C, chromosome 2 at 86,413,986 bp
  • A to T, chromosome 2 at 94,375,134 bp
  • A to T, chromosome 2 at 104,084,450 bp
  • C to T, chromosome 2 at 120,191,199 bp
  • A to G, chromosome 2 at 154,228,146 bp
  • A to T, chromosome 2 at 156,065,621 bp
  • T to C, chromosome 3 at 103,735,860 bp
  • C to T, chromosome 3 at 155,086,975 bp
  • A to G, chromosome 4 at 115,570,271 bp
  • A to T, chromosome 4 at 116,975,905 bp
  • A to T, chromosome 5 at 94,612,796 bp
  • T to C, chromosome 5 at 129,097,347 bp
  • A to G, chromosome 6 at 120,482,102 bp
  • C to A, chromosome 7 at 7,384,776 bp
  • G to A, chromosome 7 at 27,201,123 bp
  • T to C, chromosome 7 at 29,059,511 bp
  • A to G, chromosome 7 at 102,670,210 bp
  • A to T, chromosome 7 at 140,345,355 bp
  • T to C, chromosome 8 at 70,285,303 bp
  • A to C, chromosome 8 at 72,837,596 bp
  • C to T, chromosome 8 at 78,436,106 bp
  • T to C, chromosome 9 at 18,857,234 bp
  • T to C, chromosome 9 at 21,206,322 bp
  • T to C, chromosome 9 at 67,940,544 bp
  • T to C, chromosome 9 at 95,865,370 bp
  • C to T, chromosome 10 at 50,909,518 bp
  • A to T, chromosome 10 at 80,644,266 bp
  • A to G, chromosome 10 at 128,912,165 bp
  • C to T, chromosome 11 at 49,470,646 bp
  • T to A, chromosome 11 at 72,875,004 bp
  • T to C, chromosome 11 at 100,047,786 bp
  • T to C, chromosome 12 at 114,487,288 bp
  • T to G, chromosome 14 at 31,269,841 bp
  • T to C, chromosome 14 at 121,905,174 bp
  • A to T, chromosome 15 at 102,252,417 bp
  • C to T, chromosome 16 at 5,102,371 bp
  • A to G, chromosome 16 at 13,879,510 bp
  • A to G, chromosome 16 at 45,825,562 bp
  • A to G, chromosome 16 at 49,013,854 bp
  • A to C, chromosome 17 at 38,208,697 bp
  • C to T, chromosome 18 at 4,349,076 bp
  • TCGGGGCCGGGGCCGGGGCCG to TCGGGGCCGGGGCCGGGGCCGGGGCCG, chromosome X at 101,794,171 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7300 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045404-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.