Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7300Btlr/Mmmh
Stock Number:
045404-MU
Citation ID:
RRID:MMRRC_045404-MU
Other Names:
R7300 (G1)
Major Collection:

Strain Information

Sim1
Name: single-minded family bHLH transcription factor 1
Synonyms: bHLHe14
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20464
VEGA: 10
Homologene: 3715
Rarg
Name: retinoic acid receptor, gamma
Synonyms: RARgamma2, RAR gamma 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 19411
HGNC: HGNC:9866
Homologene: 20263
Map3k8
Name: mitogen-activated protein kinase kinase kinase 8
Synonyms: Cot, Tpl2, c-COT, Tpl-2, Cot/Tpl2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 26410
HGNC: HGNC:6860
Homologene: 3812
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Pdxdc1
Name: pyridoxal-dependent decarboxylase domain containing 1
Synonyms: 2210010A19Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 94184
Homologene: 22858
Ttc17
Name: tetratricopeptide repeat domain 17
Synonyms: D2Bwg1005e, 9130020K17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74569
Homologene: 10100
Atr
Name: ataxia telangiectasia and Rad3 related
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245000
HGNC: HGNC:882
Homologene: 96916
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 53,064,080 bp
  • C to T, chromosome 1 at 82,486,640 bp
  • T to A, chromosome 1 at 107,607,323 bp
  • A to G, chromosome 2 at 11,676,910 bp
  • T to C, chromosome 2 at 60,605,306 bp
  • G to A, chromosome 2 at 77,014,694 bp
  • T to C, chromosome 2 at 86,413,986 bp
  • A to T, chromosome 2 at 94,375,134 bp
  • A to T, chromosome 2 at 104,084,450 bp
  • C to T, chromosome 2 at 120,191,199 bp
  • A to G, chromosome 2 at 154,228,146 bp
  • A to T, chromosome 2 at 156,065,621 bp
  • T to C, chromosome 3 at 103,735,860 bp
  • C to T, chromosome 3 at 155,086,975 bp
  • A to G, chromosome 4 at 115,570,271 bp
  • A to T, chromosome 4 at 116,975,905 bp
  • A to T, chromosome 5 at 94,612,796 bp
  • T to C, chromosome 5 at 129,097,347 bp
  • A to G, chromosome 6 at 120,482,102 bp
  • C to A, chromosome 7 at 7,384,776 bp
  • G to A, chromosome 7 at 27,201,123 bp
  • T to C, chromosome 7 at 29,059,511 bp
  • A to G, chromosome 7 at 102,670,210 bp
  • A to T, chromosome 7 at 140,345,355 bp
  • T to C, chromosome 8 at 70,285,303 bp
  • A to C, chromosome 8 at 72,837,596 bp
  • C to T, chromosome 8 at 78,436,106 bp
  • T to C, chromosome 9 at 18,857,234 bp
  • T to C, chromosome 9 at 21,206,322 bp
  • T to C, chromosome 9 at 67,940,544 bp
  • T to C, chromosome 9 at 95,865,370 bp
  • C to T, chromosome 10 at 50,909,518 bp
  • A to T, chromosome 10 at 80,644,266 bp
  • A to G, chromosome 10 at 128,912,165 bp
  • C to T, chromosome 11 at 49,470,646 bp
  • T to A, chromosome 11 at 72,875,004 bp
  • T to C, chromosome 11 at 100,047,786 bp
  • T to C, chromosome 12 at 114,487,288 bp
  • T to G, chromosome 14 at 31,269,841 bp
  • T to C, chromosome 14 at 121,905,174 bp
  • A to T, chromosome 15 at 102,252,417 bp
  • C to T, chromosome 16 at 5,102,371 bp
  • A to G, chromosome 16 at 13,879,510 bp
  • A to G, chromosome 16 at 45,825,562 bp
  • A to G, chromosome 16 at 49,013,854 bp
  • A to C, chromosome 17 at 38,208,697 bp
  • C to T, chromosome 18 at 4,349,076 bp
  • TCGGGGCCGGGGCCGGGGCCG to TCGGGGCCGGGGCCGGGGCCGGGGCCG, chromosome X at 101,794,171 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7300 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045404-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.