Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7356Btlr/Mmmh
Stock Number:
045442-MU
Citation ID:
RRID:MMRRC_045442-MU
Other Names:
R7356 (G1)
Major Collection:

Strain Information

Prph
Name: peripherin
Synonyms: Prph1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 19132
VEGA: 15
HGNC: HGNC:9461
Homologene: 4559
Nes
Name: nestin
Synonyms: RC2, Marc2, ESTM46, Ifaprc2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18008
HGNC: HGNC:7756
Homologene: 136487
Erbb4
Name: erb-b2 receptor tyrosine kinase 4
Synonyms: ErbB4, Her4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13869
HGNC: HGNC:3432
Homologene: 21084
Plg
Name: plasminogen
Synonyms: Pg
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18815
VEGA: 17
HGNC: HGNC:9071
Homologene: 55452
Itk
Name: IL2 inducible T cell kinase
Synonyms: Emt, Tsk, Tcsk
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16428
HGNC: HGNC:6171
Homologene: 4051
Slco1a5
Name: solute carrier organic anion transporter family, member 1a5
Synonyms: Oatp3, Slc21a7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108096
Homologene: 56603
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 54,530,134 bp
  • A to G, chromosome 1 at 68,339,355 bp
  • G to T, chromosome 1 at 74,385,489 bp
  • C to T, chromosome 1 at 179,606,530 bp
  • T to C, chromosome 2 at 25,361,684 bp
  • A to G, chromosome 2 at 76,867,900 bp
  • G to A, chromosome 2 at 85,633,438 bp
  • A to G, chromosome 2 at 131,212,662 bp
  • G to A, chromosome 2 at 150,472,289 bp
  • C to A, chromosome 2 at 156,878,703 bp
  • A to T, chromosome 2 at 167,609,195 bp
  • A to G, chromosome 3 at 15,832,133 bp
  • T to C, chromosome 3 at 20,109,370 bp
  • T to C, chromosome 3 at 87,977,751 bp
  • CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT to CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT, chromosome 3 at 95,888,136 bp
  • TGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCAC to TGGTTCTGTGGTCACGGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCAC, chromosome 3 at 95,888,141 bp
  • GTTCTGTGGTCACTGGTTCTGTGGTCACTG to GTTCTGTGGTCACTGCTTCTGTGGTCACTGGTTCTGTGGTCACTG, chromosome 3 at 95,888,158 bp
  • GGTCACTGGTTCTGT to GGTCACTGGTTCTGTAGTCACTGGTTCTGT, chromosome 3 at 95,888,165 bp
  • TCTGTGGTCACTGGT to TCTGTGGTCACTGGTCCTGTGGTCACTGGT, chromosome 3 at 95,888,175 bp
  • CACTGGTT to CACTGGTTCTATGGTGACTGGTT, chromosome 3 at 95,888,183 bp
  • C to T, chromosome 3 at 138,742,432 bp
  • T to A, chromosome 4 at 11,513,595 bp
  • A to G, chromosome 4 at 40,226,600 bp
  • A to T, chromosome 4 at 49,383,507 bp
  • A to T, chromosome 4 at 66,185,266 bp
  • A to T, chromosome 4 at 96,077,418 bp
  • A to C, chromosome 4 at 108,719,015 bp
  • G to T, chromosome 4 at 109,068,480 bp
  • C to A, chromosome 4 at 141,471,924 bp
  • A to G, chromosome 5 at 120,654,825 bp
  • A to G, chromosome 5 at 143,717,087 bp
  • T to A, chromosome 6 at 13,192,642 bp
  • T to C, chromosome 6 at 84,067,461 bp
  • T to A, chromosome 6 at 142,234,732 bp
  • A to T, chromosome 7 at 14,477,106 bp
  • A to T, chromosome 7 at 19,523,774 bp
  • T to C, chromosome 7 at 38,222,121 bp
  • A to G, chromosome 7 at 43,356,431 bp
  • T to C, chromosome 7 at 45,007,784 bp
  • T to A, chromosome 7 at 98,102,683 bp
  • T to A, chromosome 7 at 99,458,878 bp
  • A to G, chromosome 7 at 100,268,119 bp
  • A to G, chromosome 7 at 105,591,710 bp
  • T to A, chromosome 7 at 113,568,142 bp
  • T to C, chromosome 7 at 126,760,915 bp
  • T to C, chromosome 7 at 137,452,724 bp
  • T to C, chromosome 7 at 140,812,115 bp
  • A to T, chromosome 8 at 61,120,960 bp
  • T to C, chromosome 8 at 71,399,564 bp
  • T to C, chromosome 8 at 92,864,983 bp
  • A to T, chromosome 8 at 110,849,866 bp
  • G to A, chromosome 9 at 21,809,899 bp
  • C to G, chromosome 9 at 24,098,261 bp
  • A to T, chromosome 9 at 55,892,211 bp
  • A to T, chromosome 9 at 76,492,853 bp
  • G to A, chromosome 10 at 33,866,583 bp
  • A to C, chromosome 10 at 61,303,280 bp
  • T to G, chromosome 11 at 46,367,832 bp
  • A to T, chromosome 11 at 60,249,027 bp
  • G to A, chromosome 11 at 69,402,165 bp
  • G to T, chromosome 11 at 89,434,773 bp
  • A to C, chromosome 12 at 52,911,864 bp
  • G to A, chromosome 12 at 87,606,277 bp
  • G to A, chromosome 13 at 70,836,280 bp
  • G to A, chromosome 14 at 50,413,702 bp
  • A to T, chromosome 15 at 91,738,744 bp
  • A to G, chromosome 15 at 99,056,926 bp
  • A to T, chromosome 15 at 100,957,579 bp
  • G to A, chromosome 16 at 13,860,003 bp
  • A to T, chromosome 16 at 23,470,243 bp
  • A to T, chromosome 16 at 58,824,355 bp
  • T to A, chromosome 16 at 97,743,149 bp
  • G to T, chromosome 17 at 12,410,911 bp
  • A to T, chromosome 17 at 15,407,696 bp
  • A to G, chromosome 17 at 21,722,620 bp
  • G to T, chromosome 18 at 60,818,094 bp
  • A to T, chromosome 18 at 61,707,550 bp
  • T to A, chromosome 19 at 50,175,157 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7356 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045442-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.