Strain Name:
C57BL/6J-MtgxR7356Btlr/Mmmh
Stock Number:
045442-MU
Citation ID:
RRID:MMRRC_045442-MU
Other Names:
R7356 (G1)
Major Collection:

Strain Information

Prph
Name: peripherin
Synonyms: Prph1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 19132
VEGA: 15
HGNC: HGNC:9461
Homologene: 4559
Nes
Name: nestin
Synonyms: RC2, Marc2, ESTM46, Ifaprc2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18008
HGNC: HGNC:7756
Homologene: 136487
Dysf
Name: dysferlin
Synonyms: 2310004N10Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 26903
HGNC: HGNC:3097
Homologene: 20748
Erbb4
Name: erb-b2 receptor tyrosine kinase 4
Synonyms: ErbB4, Her4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13869
HGNC: HGNC:3432
Homologene: 21084
Plg
Name: plasminogen
Synonyms: Pg
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18815
VEGA: 17
HGNC: HGNC:9071
Homologene: 55452
Itk
Name: IL2 inducible T cell kinase
Synonyms: Emt, Tsk, Tcsk
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16428
HGNC: HGNC:6171
Homologene: 4051
Slco1a5
Name: solute carrier organic anion transporter family, member 1a5
Synonyms: Oatp3, Slc21a7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108096
Homologene: 56603
Glrx3
Name: glutaredoxin 3
Synonyms: PKC interacting cousin of thioredoxin, PICOT, Txnl2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 30926
Homologene: 4769
Spen
Name: spen family transcription repressor
Synonyms: Mint
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56381
Homologene: 124461
Cnst
Name: consortin, connexin sorting protein
Synonyms: 9630058J23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226744
Homologene: 17139
Scn8a
Name: sodium channel, voltage-gated, type VIII, alpha
Synonyms: med, seal, motor end-plate disease, nmf2, ataxia 3, mnd2, mnd-2, C630029C19Rik, nmf58, NaCh6, Nav1.6, nmf335, NMF335, nur14
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20273
Homologene: 7927
Dock6
Name: dedicator of cytokinesis 6
Synonyms: 2410095B20Rik, 4931431C02Rik, C330023D02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319899
VEGA: 9
Homologene: 83291
Pdxdc1
Name: pyridoxal-dependent decarboxylase domain containing 1
Synonyms: 2210010A19Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 94184
Homologene: 22858
Virma
Name: vir like m6A methyltransferase associated
Synonyms: 1110037F02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66185
Homologene: 41043
Tom1l2
Name: target of myb1-like 2 (chicken)
Synonyms: 2900016I08Rik, myb1-like protein 2, A730055F12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216810
Homologene: 44901
Scaper
Name: S phase cyclin A-associated protein in the ER
Synonyms: D530014O03Rik, Zfp291
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244891
VEGA: 9
Homologene: 32488
Tcof1
Name: treacle ribosome biogenesis factor 1
Synonyms: treacle
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 21453
Homologene: 68049
Cog4
Name: component of oligomeric golgi complex 4
Synonyms: D8Ertd515e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102339
Homologene: 7155
Nek1
Name: NIMA (never in mitosis gene a)-related expressed kinase 1
Synonyms: kat, kidney, anemia and testis, D8Ertd790e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18004
HGNC: HGNC:7744
Homologene: 14376
Tspan5
Name: tetraspanin 5
Synonyms: NET-4, 4930505M03Rik, 2810455A09Rik, Tm4sf9
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56224
Homologene: 4182
Rasal1
Name: RAS protein activator like 1 (GAP1 like)
Synonyms: MRASAL
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19415
HGNC: HGNC:9873
Homologene: 3423
Lrrk2
Name: leucine-rich repeat kinase 2
Synonyms: cI-46, LOC381026, 9330188B09Rik, D630001M17Rik, 4921513O20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66725
Homologene: 18982
Osbpl9
Name: oxysterol binding protein-like 9
Synonyms: 2600011I06Rik, ORP-9
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100273
Homologene: 69380
Ube2v1
Name: ubiquitin-conjugating enzyme E2 variant 1
Synonyms: CROC1, 0610011J09Rik, D7Bwg1382e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66589
Homologene: 81888
Far1
Name: fatty acyl CoA reductase 1
Synonyms: 2600011M19Rik, 3732409C05Rik, Mlstd2, 2900034E22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67420
Homologene: 41718
Gdpd5
Name: glycerophosphodiester phosphodiesterase domain containing 5
Synonyms: Gde2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233552
Homologene: 32741
Usp42
Name: ubiquitin specific peptidase 42
Synonyms: 3110031A07Rik, 2410140K03Rik, D5Ertd591e, A630018G05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76800
Homologene: 35425
Kdm6b
Name: KDM1 lysine (K)-specific demethylase 6B
Synonyms: Jmjd3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216850
Homologene: 18945
Zfp345
Name: zinc finger protein 345
Synonyms: OTTMUSG00000015743
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 545471
Homologene: 134546
Pgap1
Name: post-GPI attachment to proteins 1
Synonyms: 5033403E17Rik, 9030223K07Rik, D230012E17Rik, PGAP1, oto
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241062
Homologene: 41605
Siglecf
Name: sialic acid binding Ig-like lectin F
Synonyms: mSiglec-F, Siglec5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233186
Homologene: 50482
Myo7a
Name: myosin VIIA
Synonyms: Myo7, USH1B, nmf371, polka, Hdb
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17921
HGNC: HGNC:7606
Homologene: 219
Prf1
Name: perforin 1 (pore forming protein)
Synonyms: perforin, Prf-1, Pfp, Pfn
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18646
VEGA: 10
HGNC: HGNC:9360
Homologene: 3698
Akap6
Name: A kinase anchor protein 6
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238161
VEGA: 12
HGNC: HGNC:376
Homologene: 3157
Mapk3
Name: mitogen-activated protein kinase 3
Synonyms: Erk-1, p44 MAP kinase, p44erk1, p44mapk, Prkm3, Erk1, Esrk1, Mtap2k
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26417
HGNC: HGNC:6877
Homologene: 55682
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Sorcs1
Name: sortilin-related VPS10 domain containing receptor 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 58178
Homologene: 10967
Nkpd1
Name: NTPase, KAP family P-loop domain containing 1
Synonyms: 2310015G09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69547
Homologene: 18876
Scaf1
Name: SR-related CTD-associated factor 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233208
Zfyve9
Name: zinc finger, FYVE domain containing 9
Synonyms: Madhip
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230597
HGNC: HGNC:6775
Homologene: 3527
Astn2
Name: astrotactin 2
Synonyms: 1d8, Astnl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56079
Homologene: 77850
Zfp941
Name: zinc finger protein 941
Synonyms: BC066028
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 407812
Pcyox1l
Name: prenylcysteine oxidase 1 like
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240334
Homologene: 23429
Pgm2l1
Name: phosphoglucomutase 2-like 1
Synonyms: BM32A, 4931406N15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70974
Homologene: 12374
Adamts16
Name: ADAM metallopeptidase with thrombospondin type 1 motif 16
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 271127
Homologene: 15146
Acnat2
Name: acyl-coenzyme A amino acid N-acyltransferase 2
Synonyms: C730036D15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 209186
Homologene: 28287
Npsr1
Name: neuropeptide S receptor 1
Synonyms: PGR14, VRR1, 9330128H10Rik, Gpr154
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319239
Homologene: 45515
Ripk4
Name: receptor-interacting serine-threonine kinase 4
Synonyms: PKK, DIk, RIP4, ANKK2, Ankrd3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 72388
HGNC: HGNC:496
Homologene: 10772
Hltf
Name: helicase-like transcription factor
Synonyms: P113, Snf2l3, Smarca3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20585
Homologene: 30136
Vwde
Name: von Willebrand factor D and EGF domains
Synonyms: LOC232585
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232585
Homologene: 35456
Sirpb1c
Name: signal-regulatory protein beta 1C
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100038947
Homologene: 82993
Masp1
Name: MBL associated serine protease 1
Synonyms: Crarf
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17174
VEGA: 16
HGNC: HGNC:6901
Homologene: 88793
Sla2
Name: Src-like-adaptor 2
Synonyms: SLAP-2, SLAP2, A930009E21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77799
Homologene: 49989
Fam83b
Name: family with sequence similarity 83, member B
Synonyms: C530008M07Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208994
Homologene: 19478
Hpx
Name: hemopexin
Synonyms: hx, Hpxn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15458
HGNC: HGNC:5171
Homologene: 511
Fam120b
Name: family with sequence similarity 120, member B
Synonyms: CCPG, 4932442K08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67544
VEGA: 17
Homologene: 13033
BC028528
Name: cDNA sequence BC028528
Synonyms: L259
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229600
Homologene: 49773
Ankfn1
Name: ankyrin-repeat and fibronectin type III domain containing 1
Synonyms: LOC382543, nmf9, 4932411E22Rik, mWAKE
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 382543
Homologene: 34996
Babam1
Name: BRISC and BRCA1 A complex member 1
Synonyms: 5430437P03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 68251
Homologene: 8574
Rigi
Name: RNA sensor RIG-I
Synonyms: 6430573D20Rik, RIG-I, DEAD (Asp-Glu-Ala-Asp) box polypeptide 58, Ddx58
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230073
Homologene: 32215
Zfp760
Name: zinc finger protein 760
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240034
VEGA: 17
Uap1l1
Name: UDP-N-acteylglucosamine pyrophosphorylase 1-like 1
Synonyms: 5730445F03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227620
Homologene: 71313
Sult3a1
Name: sulfotransferase family 3A, member 1
Synonyms: Sultx2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 57430
VEGA: 10
Homologene: 111031
Or5k8
Name: olfactory receptor family 5 subfamily K member 8
Synonyms: GA_x54KRFPKG5P-55026345-55025418, GA_x54KRFPKG5P-54993816-54992890, MOR184-10P, MOR184-1, Olfr174, Olfr175, Olfr175-ps1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 259004
Homologene: 17461
Or11g1
Name: olfactory receptor family 11 subfamily G member 1
Synonyms: GA_x6K02T2PMLR-6110726-6111661, MOR106-3, Olfr738
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258662
Homologene: 74220
Cyp2j13
Name: cytochrome P450, family 2, subfamily j, polypeptide 13
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230459
HGNC: HGNC:2634
Homologene: 138297
Plekhf1
Name: pleckstrin homology domain containing, family F (with FYVE domain) member 1
Synonyms: 1810013P09Rik, LAPF
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72287
Homologene: 11516
Ap5s1
Name: adaptor-related protein 5 complex, sigma 1 subunit
Synonyms: 0610038L13Rik, 2310035K24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69596
Homologene: 23095
Lpcat2
Name: lysophosphatidylcholine acyltransferase 2
Synonyms: Aytl1, lysoPAFAT/LPCAT2, LPCAT2, Aytl1a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270084
Homologene: 41201
Slc11a1
Name: solute carrier family 11 (proton-coupled divalent metal ion transporters), member 1
Synonyms: host resistance locus Bcg/Ity/Lsh, Nramp, Bcg, Lsh, Ity, ity, Nramp1, Ity1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18173
Homologene: 73884
Oog1
Name: oogenesin 1
Synonyms: c-1, Oog
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 193322
VEGA: 12
Homologene: 103830
Sult2a7
Name: sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 7
Synonyms: Gm7231
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 638251
Or5g24-ps1
Name: olfactory receptor family 5 subfamily G member 24, pseudogene 1
Synonyms: GA_x6K02T2Q125-47112820-47113764, MOR175-6, Olfr1001-ps1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258078
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 54,530,134 bp
  • A to G, chromosome 1 at 68,339,355 bp
  • G to T, chromosome 1 at 74,385,489 bp
  • C to T, chromosome 1 at 179,606,530 bp
  • T to C, chromosome 2 at 25,361,684 bp
  • A to G, chromosome 2 at 76,867,900 bp
  • G to A, chromosome 2 at 85,633,438 bp
  • A to G, chromosome 2 at 131,212,662 bp
  • G to A, chromosome 2 at 150,472,289 bp
  • C to A, chromosome 2 at 156,878,703 bp
  • A to T, chromosome 2 at 167,609,195 bp
  • A to G, chromosome 3 at 15,832,133 bp
  • T to C, chromosome 3 at 20,109,370 bp
  • T to C, chromosome 3 at 87,977,751 bp
  • CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT to CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT, chromosome 3 at 95,888,136 bp
  • TGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCAC to TGGTTCTGTGGTCACGGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCAC, chromosome 3 at 95,888,141 bp
  • GTTCTGTGGTCACTGGTTCTGTGGTCACTG to GTTCTGTGGTCACTGCTTCTGTGGTCACTGGTTCTGTGGTCACTG, chromosome 3 at 95,888,158 bp
  • GGTCACTGGTTCTGT to GGTCACTGGTTCTGTAGTCACTGGTTCTGT, chromosome 3 at 95,888,165 bp
  • TCTGTGGTCACTGGT to TCTGTGGTCACTGGTCCTGTGGTCACTGGT, chromosome 3 at 95,888,175 bp
  • CACTGGTT to CACTGGTTCTATGGTGACTGGTT, chromosome 3 at 95,888,183 bp
  • C to T, chromosome 3 at 138,742,432 bp
  • T to A, chromosome 4 at 11,513,595 bp
  • A to G, chromosome 4 at 40,226,600 bp
  • A to T, chromosome 4 at 49,383,507 bp
  • A to T, chromosome 4 at 66,185,266 bp
  • A to T, chromosome 4 at 96,077,418 bp
  • A to C, chromosome 4 at 108,719,015 bp
  • G to T, chromosome 4 at 109,068,480 bp
  • C to A, chromosome 4 at 141,471,924 bp
  • A to G, chromosome 5 at 120,654,825 bp
  • A to G, chromosome 5 at 143,717,087 bp
  • T to A, chromosome 6 at 13,192,642 bp
  • T to C, chromosome 6 at 84,067,461 bp
  • T to A, chromosome 6 at 142,234,732 bp
  • A to T, chromosome 7 at 14,477,106 bp
  • A to T, chromosome 7 at 19,523,774 bp
  • T to C, chromosome 7 at 38,222,121 bp
  • A to G, chromosome 7 at 43,356,431 bp
  • T to C, chromosome 7 at 45,007,784 bp
  • T to A, chromosome 7 at 98,102,683 bp
  • T to A, chromosome 7 at 99,458,878 bp
  • A to G, chromosome 7 at 100,268,119 bp
  • A to G, chromosome 7 at 105,591,710 bp
  • T to A, chromosome 7 at 113,568,142 bp
  • T to C, chromosome 7 at 126,760,915 bp
  • T to C, chromosome 7 at 137,452,724 bp
  • T to C, chromosome 7 at 140,812,115 bp
  • A to T, chromosome 8 at 61,120,960 bp
  • T to C, chromosome 8 at 71,399,564 bp
  • T to C, chromosome 8 at 92,864,983 bp
  • A to T, chromosome 8 at 110,849,866 bp
  • G to A, chromosome 9 at 21,809,899 bp
  • C to G, chromosome 9 at 24,098,261 bp
  • A to T, chromosome 9 at 55,892,211 bp
  • A to T, chromosome 9 at 76,492,853 bp
  • G to A, chromosome 10 at 33,866,583 bp
  • A to C, chromosome 10 at 61,303,280 bp
  • T to G, chromosome 11 at 46,367,832 bp
  • A to T, chromosome 11 at 60,249,027 bp
  • G to A, chromosome 11 at 69,402,165 bp
  • G to T, chromosome 11 at 89,434,773 bp
  • A to C, chromosome 12 at 52,911,864 bp
  • G to A, chromosome 12 at 87,606,277 bp
  • G to A, chromosome 13 at 70,836,280 bp
  • G to A, chromosome 14 at 50,413,702 bp
  • A to T, chromosome 15 at 91,738,744 bp
  • A to G, chromosome 15 at 99,056,926 bp
  • A to T, chromosome 15 at 100,957,579 bp
  • G to A, chromosome 16 at 13,860,003 bp
  • A to T, chromosome 16 at 23,470,243 bp
  • A to T, chromosome 16 at 58,824,355 bp
  • T to A, chromosome 16 at 97,743,149 bp
  • G to T, chromosome 17 at 12,410,911 bp
  • A to T, chromosome 17 at 15,407,696 bp
  • A to G, chromosome 17 at 21,722,620 bp
  • G to T, chromosome 18 at 60,818,094 bp
  • A to T, chromosome 18 at 61,707,550 bp
  • T to A, chromosome 19 at 50,175,157 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7356 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045442-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.