Strain Name:
C57BL/6J-MtgxR7387Btlr/Mmmh
Stock Number:
045469-MU
Citation ID:
RRID:MMRRC_045469-MU
Other Names:
R7387 (G1)
Major Collection:

Strain Information

Ntrk2
Name: neurotrophic tyrosine kinase, receptor, type 2
Synonyms: trkB, C030027L06Rik, Tkrb
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18212
VEGA: 13
HGNC: HGNC:8032
Homologene: 4504
H2-DMa
Name: histocompatibility 2, class II, locus DMa
Synonyms: H2-Ma, H-2Ma, H2-M alpha
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14998
HGNC: HGNC:4934
Homologene: 4464
Ece1
Name: endothelin converting enzyme 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230857
HGNC: HGNC:3146
Homologene: 1068
Iqgap1
Name: IQ motif containing GTPase activating protein 1
Synonyms: D7Ertd237e, D7Ertd257e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 29875
HGNC: HGNC:6110
Homologene: 74514
Phf20
Name: PHD finger protein 20
Synonyms: 6820402O20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228829
Homologene: 9507
Sgsm1
Name: small G protein signaling modulator 1
Synonyms: 2410098H20Rik, D5Bwg1524e, Rutbc2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52850
Homologene: 64485
Zdbf2
Name: zinc finger, DBF-type containing 2
Synonyms: 9330107J05Rik, 4930431J08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73884
Homologene: 52868
Pelp1
Name: proline, glutamic acid and leucine rich protein 1
Synonyms: 4930563C04Rik, MNAR
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 75273
Homologene: 8664
Cdc6
Name: cell division cycle 6
Synonyms: cell division cycle 18 homolog (S.pombe)-like, CDC18L, CDC18(S.pombe)
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23834
HGNC: HGNC:1744
Homologene: 68172
Pml
Name: promyelocytic leukemia
Synonyms: Trim19, 1200009E24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18854
HGNC: HGNC:9113
Homologene: 13245
Mllt6
Name: myeloid/lymphoid or mixed-lineage leukemia; translocated to, 6
Synonyms: Af17
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 246198
HGNC: HGNC:7138
Homologene: 31347
Kif11
Name: kinesin family member 11
Synonyms: Eg5, Knsl1, Kifl1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16551
VEGA: 19
HGNC: HGNC:6388
Homologene: 3322
Sec23ip
Name: Sec23 interacting protein
Synonyms: D7Ertd373e, p125
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 207352
Homologene: 38288
Cad
Name: carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Synonyms: 2410008J01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69719
HGNC: HGNC:1424
Homologene: 1412
Med27
Name: mediator complex subunit 27
Synonyms: 1500015J03Rik, 2310042P07Rik, D2Ertd434e, Crsp8
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68975
HGNC: HGNC:2377
Homologene: 3152
Arid4a
Name: AT-rich interaction domain 4A
Synonyms: A630067N03Rik, Rbbp1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238247
HGNC: HGNC:9885
Homologene: 11303
Atg2b
Name: autophagy related 2B
Synonyms: C630028L02Rik, C030004M05Rik, 2410024A21Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76559
VEGA: 12
Homologene: 9974
Abcg2
Name: ATP binding cassette subfamily G member 2 (Junior blood group)
Synonyms: Bcrp, 4930430M16Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 26357
HGNC: HGNC:74
Homologene: 55852
Mrps5
Name: mitochondrial ribosomal protein S5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77721
Homologene: 32726
Vars1
Name: valyl-tRNA synthetase 1
Synonyms: G7a, D17H6S56E, Bat-6, Bat6, Vars2, Vars
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22321
Homologene: 4587
Sqle
Name: squalene epoxidase
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20775
Homologene: 2355
Ern1
Name: endoplasmic reticulum to nucleus signalling 1
Synonyms: 9030414B18Rik, Ire1p, Ire1alpha, Ire1a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78943
HGNC: HGNC:3449
Homologene: 55580
Rreb1
Name: ras responsive element binding protein 1
Synonyms: 1110037N09Rik, B930013M22Rik, sao
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68750
Homologene: 2218
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, Dnchc2, b2b414Clo, m407Asp, m152Asp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Cenpe
Name: centromere protein E
Synonyms: N-7 kinesin, CENP-E, 312kDa, Kif10
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229841
HGNC: HGNC:1856
Homologene: 20429
Itsn2
Name: intersectin 2
Synonyms: Sh3p18, Ese2, Eh domain, SH3 domain regulator of endocytosis 2, Sh3d1B
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20403
VEGA: 12
HGNC: HGNC:6184
Homologene: 22627
Pcnx3
Name: pecanex homolog 3
Synonyms: Pcnxl3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 104401
Homologene: 17000
Patl1
Name: protein associated with topoisomerase II homolog 1 (yeast)
Synonyms: Pat1b
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225929
VEGA: 19
Homologene: 82269
Cachd1
Name: cache domain containing 1
Synonyms: 1190007F10Rik, Vwcd1, B430218L07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320508
Homologene: 10854
Fam168b
Name: family with sequence similarity 168, member B
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 214469
Homologene: 18390
Pkd1l1
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171395
Homologene: 51376
Prss35
Name: serine protease 35
Synonyms: 6030424L22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244954
Homologene: 17734
Kcnd2
Name: potassium voltage-gated channel, Shal-related family, member 2
Synonyms: Kv4.2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16508
HGNC: HGNC:6238
Homologene: 40828
Dnah6
Name: dynein, axonemal, heavy chain 6
Synonyms: A730004I20Rik, Dnahc6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330355
HGNC: HGNC:2951
Homologene: 15221
Spats2l
Name: spermatogenesis associated, serine-rich 2-like
Synonyms: A230104H11Rik, 2810022L02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67198
Homologene: 56711
Cpsf1
Name: cleavage and polyadenylation specific factor 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 94230
VEGA: 15
HGNC: HGNC:2324
Homologene: 40865
Add2
Name: adducin 2
Synonyms: 2900072M03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11519
HGNC: HGNC:244
Homologene: 1221
Nlrp14
Name: NLR family, pyrin domain containing 14
Synonyms: 4921520L01Rik, Nalp14, GC-LRR, Nalp-iota
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76858
Homologene: 18531
Nlrp12
Name: NLR family, pyrin domain containing 12
Synonyms: Nalp12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 378425
Homologene: 16972
Lrp4
Name: low density lipoprotein receptor-related protein 4
Synonyms: 6430526J12Rik, Megf7, mdig
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228357
HGNC: HGNC:6696
Homologene: 17964
Myh1
Name: myosin, heavy polypeptide 1, skeletal muscle, adult
Synonyms: MyHC-IId/x, Myhs-f, Myhs-f2, Myhsf2, A530084A17Rik, MYHC-IIX, myosin heavy chain 2X, IId, IId/x
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17879
HGNC: HGNC:7567
Homologene: 133718
Exoc3l
Name: exocyst complex component 3-like
Synonyms: C730015A04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 277978
Homologene: 18629
Cped1
Name: cadherin-like and PC-esterase domain containing 1
Synonyms: A430107O13Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 214642
Homologene: 57014
Ccdc110
Name: coiled-coil domain containing 110
Synonyms: LOC212392
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 212392
Homologene: 17668
Adcy5
Name: adenylate cyclase 5
Synonyms: AC5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224129
VEGA: 16
HGNC: HGNC:236
Homologene: 11213
Or4c100
Name: olfactory receptor family 4 subfamily C member 100
Synonyms: GA_x6K02T2Q125-50012960-50013871, MOR230-5, Olfr1186
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258523
Homologene: 110555
Stil
Name: Scl/Tal1 interrupting locus
Synonyms: Sil
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20460
Homologene: 2283
Abca6
Name: ATP-binding cassette, sub-family A member 6
Synonyms: 6330565N06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76184
HGNC: HGNC:36
Homologene: 71264
Mettl2
Name: methyltransferase 2, methylcytidine
Synonyms: C130031G21Rik, PSENIP1, D11Ertd768e, 2810438F06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 52686
Homologene: 10174
Ogfr
Name: opioid growth factor receptor
Synonyms: 2010013E17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72075
Homologene: 7199
Or52e4
Name: olfactory receptor family 52 subfamily E member 4
Synonyms: GA_x6K02T2PBJ9-7685262-7686200, MOR32-11, Olfr677
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258355
Homologene: 81596
Atg2a
Name: autophagy related 2A
Synonyms: 1810013C15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 329015
Homologene: 86985
Nup210
Name: nucleoporin 210
Synonyms: gp210, gp190, Pom210
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54563
Homologene: 41286
Dpp10
Name: dipeptidylpeptidase 10
Synonyms: 6430601K09Rik, DPRP3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269109
Homologene: 41400
Tmem184c
Name: transmembrane protein 184C
Synonyms: 8430433H16Rik, Tmem34
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234463
Homologene: 32403
Adck1
Name: aarF domain containing kinase 1
Synonyms: 2610005A10Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72113
VEGA: 12
Homologene: 6493
Rccd1
Name: RCC1 domain containing 1
Synonyms: E430018M08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269955
Homologene: 16782
Nr1i2
Name: nuclear receptor subfamily 1, group I, member 2
Synonyms: PXR.2, PXR.1, Pregnane X receptor, mPXR, PXR, SXR
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 18171
HGNC: HGNC:7968
Homologene: 40757
Lrrtm2
Name: leucine rich repeat transmembrane neuronal 2
Synonyms: C630011A14Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 107065
VEGA: 18
Homologene: 65342
Itga10
Name: integrin, alpha 10
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213119
HGNC: HGNC:6135
Homologene: 2697
Trim30c
Name: tripartite motif-containing 30C
Synonyms: Trim30-2, Gm5598
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434219
Strip1
Name: striatin interacting protein 1
Synonyms: 6530401O14Rik, 6330569M22Rik, Fam40a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229707
Homologene: 35064
Tmem163
Name: transmembrane protein 163
Synonyms: 2610024A01Rik, SV31
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72160
Homologene: 12798
Itih2
Name: inter-alpha trypsin inhibitor, heavy chain 2
Synonyms: Intin2, Itih-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16425
HGNC: HGNC:6167
Homologene: 1668
Cdhr4
Name: cadherin-related family member 4
Synonyms: D330022A01Rik, 1700021K14Rik, Cdh29
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69398
Homologene: 82362
Zfp819
Name: zinc finger protein 819
Synonyms: 4930427I11Rik, 4933405K07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74400
Homologene: 128446
4930522H14Rik
Name: RIKEN cDNA 4930522H14 gene
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67646
Homologene: 49856
B3gntl1
Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1
Synonyms: 6030413G23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 210004
Homologene: 14460
Tcp11l1
Name: t-complex 11 like 1
Synonyms: C130096D04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320554
Homologene: 41260
Dus2
Name: dihydrouridine synthase 2
Synonyms: 2310016K04Rik, Dus2l
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66369
Homologene: 6838
Cma2
Name: chymase 2, mast cell
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 545055
VEGA: 14
Homologene: 115745
Fez1
Name: fasciculation and elongation protein zeta 1
Synonyms: UNC-76, UNC76, zygin I
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235180
HGNC: HGNC:3659
Homologene: 21063
Pknox2
Name: Pbx/knotted 1 homeobox 2
Synonyms: Prep2, D230005H23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208076
Homologene: 32527
Rcor3
Name: REST corepressor 3
Synonyms: E130101E15Rik, 4921514E24Rik, C730034D20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 214742
Homologene: 135671
Ldlrad2
Name: low density lipoprotein receptor class A domain containing 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 435811
VEGA: 4
Homologene: 54811
Tmem30c
Name: transmembrane protein 30C
Synonyms: 4933409A18Rik, 4933401B01Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 71027
Homologene: 78138
H2-Eb1
Name: histocompatibility 2, class II antigen E beta
Synonyms: H-2Eb, Ia-4, Ia4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14969
Homologene: 101524
Spopl
Name: speckle-type BTB/POZ protein-like
Synonyms: E430033K04Rik, 4921517N04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76857
Homologene: 78016
Inka1
Name: inka box actin regulator 1
Synonyms: Inka1, 6230427J02Rik, Fam212a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68176
Homologene: 19818
BC035947
Name: cDNA sequence BC035947
Type: Gene
Species: Mouse
Chromosome: 1
Clec4a1
Name: C-type lectin domain family 4, member a1
Synonyms: mDcir4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 269799
Homologene: 72399
Scgb2b12
Name: secretoglobin, family 2B, member 12
Synonyms: Gm9138, Abpbg12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 668379
Homologene: 83171
Mcidas
Name: multiciliate differentiation and DNA synthesis associated cell cycle protein
Synonyms: Gm6320, Idas, multicilin, Mci, Mcin
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 622408
VEGA: 13
Homologene: 83681
Slc25a51
Name: solute carrier family 25, member 51
Synonyms: D130005A03Rik, 9130208E07Rik, Mcart1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230125
Homologene: 88487
Or5h27
Name: olfactory receptor family 5 subfamily H member 27, pseudogene 1
Synonyms: GA_x54KRFPKG5P-55400292-55399363, MOR183-3, Olfr197
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258477
Homologene: 36984
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 34,819,708 bp
  • T to C, chromosome 1 at 57,902,134 bp
  • G to A, chromosome 1 at 63,304,039 bp
  • A to G, chromosome 1 at 78,498,461 bp
  • T to C, chromosome 1 at 123,341,140 bp
  • T to C, chromosome 1 at 127,519,443 bp
  • T to C, chromosome 1 at 192,137,524 bp
  • C to T, chromosome 2 at 10,130,508 bp
  • A to T, chromosome 2 at 23,537,509 bp
  • T to A, chromosome 2 at 29,413,407 bp
  • T to A, chromosome 2 at 88,526,400 bp
  • T to C, chromosome 2 at 91,476,614 bp
  • C to A, chromosome 2 at 104,699,930 bp
  • C to T, chromosome 2 at 127,600,884 bp
  • T to C, chromosome 2 at 156,294,240 bp
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp
  • A to T, chromosome 3 at 96,652,778 bp
  • T to A, chromosome 3 at 107,625,730 bp
  • T to G, chromosome 3 at 135,247,037 bp
  • A to T, chromosome 4 at 45,399,841 bp
  • T to C, chromosome 4 at 100,777,178 bp
  • A to G, chromosome 4 at 109,505,577 bp
  • T to G, chromosome 4 at 115,024,036 bp
  • C to T, chromosome 4 at 137,574,517 bp
  • T to A, chromosome 4 at 137,938,784 bp
  • T to C, chromosome 5 at 31,061,940 bp
  • A to C, chromosome 5 at 113,263,700 bp
  • T to A, chromosome 6 at 21,216,778 bp
  • A to T, chromosome 6 at 22,059,934 bp
  • A to T, chromosome 6 at 58,689,624 bp
  • G to A, chromosome 6 at 73,212,612 bp
  • A to G, chromosome 6 at 86,086,015 bp
  • C to T, chromosome 6 at 91,021,396 bp
  • T to G, chromosome 6 at 122,922,057 bp
  • G to T, chromosome 7 at 3,241,201 bp
  • T to A, chromosome 7 at 32,326,635 bp
  • T to G, chromosome 7 at 43,612,641 bp
  • T to A, chromosome 7 at 80,320,602 bp
  • C to T, chromosome 7 at 80,720,990 bp
  • T to A, chromosome 7 at 104,390,190 bp
  • T to A, chromosome 7 at 105,057,090 bp
  • T to C, chromosome 7 at 107,183,107 bp
  • C to T, chromosome 7 at 128,745,003 bp
  • A to T, chromosome 8 at 45,942,196 bp
  • A to T, chromosome 8 at 77,597,930 bp
  • A to G, chromosome 8 at 105,294,973 bp
  • G to A, chromosome 8 at 106,045,987 bp
  • T to C, chromosome 9 at 7,157,932 bp
  • T to A, chromosome 9 at 18,641,720 bp
  • T to C, chromosome 9 at 36,867,812 bp
  • G to T, chromosome 9 at 36,957,068 bp
  • T to C, chromosome 9 at 58,229,894 bp
  • C to T, chromosome 9 at 86,755,921 bp
  • C to T, chromosome 9 at 107,984,427 bp
  • T to A, chromosome 9 at 107,996,912 bp
  • T to A, chromosome 11 at 8,901,203 bp
  • A to T, chromosome 11 at 67,208,889 bp
  • G to A, chromosome 11 at 70,396,599 bp
  • C to A, chromosome 11 at 97,674,600 bp
  • C to T, chromosome 11 at 98,908,216 bp
  • T to C, chromosome 11 at 105,132,538 bp
  • A to T, chromosome 11 at 106,421,952 bp
  • A to G, chromosome 11 at 110,202,420 bp
  • A to G, chromosome 11 at 121,629,915 bp
  • A to T, chromosome 12 at 4,639,781 bp
  • T to A, chromosome 12 at 71,087,496 bp
  • A to G, chromosome 12 at 88,461,052 bp
  • T to C, chromosome 12 at 105,622,775 bp
  • G to A, chromosome 12 at 114,914,868 bp
  • A to G, chromosome 13 at 37,947,064 bp
  • A to G, chromosome 13 at 58,985,979 bp
  • T to C, chromosome 13 at 112,994,088 bp
  • A to G, chromosome 14 at 55,973,048 bp
  • G to A, chromosome 15 at 59,330,754 bp
  • A to T, chromosome 15 at 76,602,566 bp
  • T to C, chromosome 16 at 35,272,090 bp
  • T to C, chromosome 16 at 38,266,080 bp
  • T to C, chromosome 16 at 57,270,023 bp
  • A to T, chromosome 16 at 59,186,336 bp
  • T to C, chromosome 17 at 34,138,127 bp
  • T to A, chromosome 17 at 34,314,233 bp
  • C to T, chromosome 17 at 35,004,792 bp
  • T to C, chromosome 18 at 35,212,972 bp
  • A to G, chromosome 19 at 5,673,336 bp
  • G to T, chromosome 19 at 6,255,168 bp
  • A to G, chromosome 19 at 11,933,730 bp
  • T to A, chromosome 19 at 37,409,756 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7387 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045469-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.