Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7387Btlr/Mmmh
Stock Number:
045469-MU
Citation ID:
RRID:MMRRC_045469-MU
Other Names:
R7387 (G1)
Major Collection:

Strain Information

Ntrk2
Name: neurotrophic tyrosine kinase, receptor, type 2
Synonyms: trkB, C030027L06Rik, Tkrb
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18212
VEGA: 13
HGNC: HGNC:8032
Homologene: 4504
H2-DMa
Name: histocompatibility 2, class II, locus DMa
Synonyms: H2-Ma, H-2Ma, H2-M alpha
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14998
HGNC: HGNC:4934
Homologene: 4464
Ece1
Name: endothelin converting enzyme 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230857
HGNC: HGNC:3146
Homologene: 1068
Iqgap1
Name: IQ motif containing GTPase activating protein 1
Synonyms: D7Ertd237e, D7Ertd257e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 29875
HGNC: HGNC:6110
Homologene: 74514
Phf20
Name: PHD finger protein 20
Synonyms: 6820402O20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228829
Homologene: 9507
Sgsm1
Name: small G protein signaling modulator 1
Synonyms: 2410098H20Rik, D5Bwg1524e, Rutbc2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52850
Homologene: 64485
Zdbf2
Name: zinc finger, DBF-type containing 2
Synonyms: 9330107J05Rik, 4930431J08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73884
Homologene: 52868
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 34,819,708 bp
  • T to C, chromosome 1 at 57,902,134 bp
  • G to A, chromosome 1 at 63,304,039 bp
  • A to G, chromosome 1 at 78,498,461 bp
  • T to C, chromosome 1 at 123,341,140 bp
  • T to C, chromosome 1 at 127,519,443 bp
  • T to C, chromosome 1 at 192,137,524 bp
  • C to T, chromosome 2 at 10,130,508 bp
  • A to T, chromosome 2 at 23,537,509 bp
  • T to A, chromosome 2 at 29,413,407 bp
  • T to A, chromosome 2 at 88,526,400 bp
  • T to C, chromosome 2 at 91,476,614 bp
  • C to A, chromosome 2 at 104,699,930 bp
  • C to T, chromosome 2 at 127,600,884 bp
  • T to C, chromosome 2 at 156,294,240 bp
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp
  • A to T, chromosome 3 at 96,652,778 bp
  • T to A, chromosome 3 at 107,625,730 bp
  • T to G, chromosome 3 at 135,247,037 bp
  • A to T, chromosome 4 at 45,399,841 bp
  • T to C, chromosome 4 at 100,777,178 bp
  • A to G, chromosome 4 at 109,505,577 bp
  • T to G, chromosome 4 at 115,024,036 bp
  • C to T, chromosome 4 at 137,574,517 bp
  • T to A, chromosome 4 at 137,938,784 bp
  • T to C, chromosome 5 at 31,061,940 bp
  • A to C, chromosome 5 at 113,263,700 bp
  • T to A, chromosome 6 at 21,216,778 bp
  • A to T, chromosome 6 at 22,059,934 bp
  • A to T, chromosome 6 at 58,689,624 bp
  • G to A, chromosome 6 at 73,212,612 bp
  • A to G, chromosome 6 at 86,086,015 bp
  • C to T, chromosome 6 at 91,021,396 bp
  • T to G, chromosome 6 at 122,922,057 bp
  • G to T, chromosome 7 at 3,241,201 bp
  • T to A, chromosome 7 at 32,326,635 bp
  • T to G, chromosome 7 at 43,612,641 bp
  • T to A, chromosome 7 at 80,320,602 bp
  • C to T, chromosome 7 at 80,720,990 bp
  • T to A, chromosome 7 at 104,390,190 bp
  • T to A, chromosome 7 at 105,057,090 bp
  • T to C, chromosome 7 at 107,183,107 bp
  • C to T, chromosome 7 at 128,745,003 bp
  • A to T, chromosome 8 at 45,942,196 bp
  • A to T, chromosome 8 at 77,597,930 bp
  • A to G, chromosome 8 at 105,294,973 bp
  • G to A, chromosome 8 at 106,045,987 bp
  • T to C, chromosome 9 at 7,157,932 bp
  • T to A, chromosome 9 at 18,641,720 bp
  • T to C, chromosome 9 at 36,867,812 bp
  • G to T, chromosome 9 at 36,957,068 bp
  • T to C, chromosome 9 at 58,229,894 bp
  • C to T, chromosome 9 at 86,755,921 bp
  • C to T, chromosome 9 at 107,984,427 bp
  • T to A, chromosome 9 at 107,996,912 bp
  • T to A, chromosome 11 at 8,901,203 bp
  • A to T, chromosome 11 at 67,208,889 bp
  • G to A, chromosome 11 at 70,396,599 bp
  • C to A, chromosome 11 at 97,674,600 bp
  • C to T, chromosome 11 at 98,908,216 bp
  • T to C, chromosome 11 at 105,132,538 bp
  • A to T, chromosome 11 at 106,421,952 bp
  • A to G, chromosome 11 at 110,202,420 bp
  • A to G, chromosome 11 at 121,629,915 bp
  • A to T, chromosome 12 at 4,639,781 bp
  • T to A, chromosome 12 at 71,087,496 bp
  • A to G, chromosome 12 at 88,461,052 bp
  • T to C, chromosome 12 at 105,622,775 bp
  • G to A, chromosome 12 at 114,914,868 bp
  • A to G, chromosome 13 at 37,947,064 bp
  • A to G, chromosome 13 at 58,985,979 bp
  • T to C, chromosome 13 at 112,994,088 bp
  • A to G, chromosome 14 at 55,973,048 bp
  • G to A, chromosome 15 at 59,330,754 bp
  • A to T, chromosome 15 at 76,602,566 bp
  • T to C, chromosome 16 at 35,272,090 bp
  • T to C, chromosome 16 at 38,266,080 bp
  • T to C, chromosome 16 at 57,270,023 bp
  • A to T, chromosome 16 at 59,186,336 bp
  • T to C, chromosome 17 at 34,138,127 bp
  • T to A, chromosome 17 at 34,314,233 bp
  • C to T, chromosome 17 at 35,004,792 bp
  • T to C, chromosome 18 at 35,212,972 bp
  • A to G, chromosome 19 at 5,673,336 bp
  • G to T, chromosome 19 at 6,255,168 bp
  • A to G, chromosome 19 at 11,933,730 bp
  • T to A, chromosome 19 at 37,409,756 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7387 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045469-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.