Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7424Btlr/Mmmh
Stock Number:
045502-MU
Citation ID:
RRID:MMRRC_045502-MU
Other Names:
R7424 (G1)
Major Collection:

Strain Information

Ndrg1
Name: N-myc downstream regulated gene 1
Synonyms: Tdd5, PROXY1, CMT4D, CAP43, TDD5, DRG1, Ndr1, Ndrl
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17988
HGNC: HGNC:7679
Homologene: 55953
Mtap
Name: methylthioadenosine phosphorylase
Synonyms: 1300019I21Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66902
HGNC: HGNC:7413
Homologene: 1838
Nsfl1c
Name: NSFL1 (p97) cofactor (p47)
Synonyms: p47
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 386649
Homologene: 41114
Uaca
Name: uveal autoantigen with coiled-coil domains and ankyrin repeats
Synonyms: nucling, 2700059D02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72565
VEGA: 9
Homologene: 74297
Ddx5
Name: DEAD box helicase 5
Synonyms: p68, Hlr1, 2600009A06Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13207
HGNC: HGNC:2746
Homologene: 6797
Trip11
Name: thyroid hormone receptor interactor 11
Synonyms: 3110031G15Rik, 2610511G22Rik, 6030460N08Rik, TRIP230, GMAP-210
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 109181
Homologene: 20897
Ranbp2
Name: RAN binding protein 2
Synonyms: A430087B05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19386
VEGA: 10
HGNC: HGNC:9848
Homologene: 87808
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 66,414,824 bp
  • T to G, chromosome 1 at 72,680,058 bp
  • A to T, chromosome 1 at 93,054,317 bp
  • C to T, chromosome 1 at 150,630,266 bp
  • T to A, chromosome 1 at 164,260,876 bp
  • T to A, chromosome 1 at 194,806,339 bp
  • C to T, chromosome 2 at 3,489,041 bp
  • T to C, chromosome 2 at 10,245,637 bp
  • A to G, chromosome 2 at 52,038,216 bp
  • T to C, chromosome 2 at 76,740,990 bp
  • A to G, chromosome 2 at 76,932,143 bp
  • A to G, chromosome 2 at 132,869,743 bp
  • A to G, chromosome 2 at 151,500,753 bp
  • A to G, chromosome 2 at 153,890,540 bp
  • A to G, chromosome 2 at 156,097,303 bp
  • A to T, chromosome 3 at 65,266,503 bp
  • A to T, chromosome 3 at 100,202,066 bp
  • A to T, chromosome 3 at 103,088,442 bp
  • A to T, chromosome 4 at 40,730,244 bp
  • C to T, chromosome 4 at 43,172,235 bp
  • A to T, chromosome 4 at 88,827,807 bp
  • T to G, chromosome 4 at 89,179,462 bp
  • C to A, chromosome 4 at 106,379,107 bp
  • A to T, chromosome 4 at 138,871,266 bp
  • C to T, chromosome 4 at 143,853,209 bp
  • A to T, chromosome 4 at 145,148,747 bp
  • A to T, chromosome 5 at 15,029,372 bp
  • T to A, chromosome 5 at 147,536,272 bp
  • A to T, chromosome 6 at 72,517,164 bp
  • T to C, chromosome 7 at 8,255,329 bp
  • T to C, chromosome 7 at 13,734,897 bp
  • A to T, chromosome 7 at 22,499,080 bp
  • T to C, chromosome 7 at 24,432,228 bp
  • C to T, chromosome 7 at 24,606,251 bp
  • T to C, chromosome 7 at 30,322,043 bp
  • T to C, chromosome 7 at 45,498,778 bp
  • T to A, chromosome 7 at 46,225,555 bp
  • T to A, chromosome 7 at 73,960,902 bp
  • G to A, chromosome 7 at 85,563,868 bp
  • G to C, chromosome 7 at 104,588,700 bp
  • T to A, chromosome 7 at 127,317,365 bp
  • T to A, chromosome 7 at 140,007,924 bp
  • C to A, chromosome 8 at 41,022,406 bp
  • T to G, chromosome 8 at 72,675,173 bp
  • G to T, chromosome 8 at 88,585,175 bp
  • C to T, chromosome 8 at 120,145,545 bp
  • A to G, chromosome 9 at 49,418,750 bp
  • T to A, chromosome 9 at 59,708,071 bp
  • A to G, chromosome 9 at 60,870,110 bp
  • G to T, chromosome 10 at 7,907,483 bp
  • T to G, chromosome 10 at 58,479,194 bp
  • A to T, chromosome 10 at 74,506,485 bp
  • T to C, chromosome 10 at 75,157,100 bp
  • G to T, chromosome 10 at 130,418,980 bp
  • A to T, chromosome 11 at 67,213,663 bp
  • A to G, chromosome 11 at 69,000,092 bp
  • A to T, chromosome 11 at 99,518,091 bp
  • A to T, chromosome 11 at 100,135,560 bp
  • A to T, chromosome 11 at 106,782,180 bp
  • A to T, chromosome 11 at 116,595,629 bp
  • A to T, chromosome 11 at 118,184,009 bp
  • T to A, chromosome 12 at 10,381,391 bp
  • A to G, chromosome 12 at 81,724,097 bp
  • A to T, chromosome 12 at 101,885,198 bp
  • T to A, chromosome 13 at 32,968,667 bp
  • G to T, chromosome 13 at 74,257,545 bp
  • T to C, chromosome 14 at 20,577,040 bp
  • T to C, chromosome 14 at 70,594,007 bp
  • T to A, chromosome 14 at 72,435,777 bp
  • T to C, chromosome 15 at 66,944,938 bp
  • A to T, chromosome 16 at 19,407,194 bp
  • G to A, chromosome 16 at 31,884,946 bp
  • A to T, chromosome 16 at 55,990,487 bp
  • AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG, chromosome 16 at 91,660,334 bp
  • T to C, chromosome 17 at 25,037,036 bp
  • T to C, chromosome 17 at 35,853,309 bp
  • T to C, chromosome 18 at 32,819,080 bp
  • A to T, chromosome 19 at 12,240,954 bp
  • A to T, chromosome 19 at 23,718,101 bp
  • A to G, chromosome 19 at 34,573,198 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7424 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045502-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.