Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7430Btlr/Mmmh
Stock Number:
045508-MU
Citation ID:
RRID:MMRRC_045508-MU
Other Names:
R7430 (G1)
Major Collection:

Strain Information

Fgb
Name: fibrinogen beta chain
Synonyms: 2510049G14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 110135
HGNC: HGNC:3662
Homologene: 3772
Rptor
Name: regulatory associated protein of MTOR, complex 1
Synonyms: raptor, 4932417H02Rik, Rap
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74370
Homologene: 80210
Slco1a5
Name: solute carrier organic anion transporter family, member 1a5
Synonyms: Oatp3, Slc21a7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108096
Homologene: 56603
Slc2a1
Name: solute carrier family 2 (facilitated glucose transporter), member 1
Synonyms: Glut-1, Glut1, M100200, Rgsc200
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20525
Homologene: 68520
Plcb4
Name: phospholipase C, beta 4
Synonyms: C230058B11Rik, A930039J07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18798
HGNC: HGNC:9059
Homologene: 8471
Cyfip1
Name: cytoplasmic FMR1 interacting protein 1
Synonyms: P140SRA-1, Shyc, pl-1, l(7)1Rl, Sra-1, E030028J09Rik, l7Rl1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20430
Homologene: 22628
Ankrd17
Name: ankyrin repeat domain 17
Synonyms: Gtar, 4933425K22Rik, A130069E23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 81702
Homologene: 82403
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 9,872,258 bp
  • C to A, chromosome 1 at 91,423,983 bp
  • T to A, chromosome 1 at 171,417,727 bp
  • C to T, chromosome 1 at 173,755,681 bp
  • G to T, chromosome 2 at 13,322,993 bp
  • T to C, chromosome 2 at 63,979,060 bp
  • T to A, chromosome 2 at 76,810,939 bp
  • G to A, chromosome 2 at 83,794,258 bp
  • A to T, chromosome 2 at 126,403,371 bp
  • T to C, chromosome 2 at 135,968,322 bp
  • A to G, chromosome 2 at 160,898,666 bp
  • T to A, chromosome 3 at 38,887,450 bp
  • A to G, chromosome 3 at 39,009,644 bp
  • T to A, chromosome 3 at 54,370,202 bp
  • C to T, chromosome 3 at 83,046,707 bp
  • C to T, chromosome 3 at 92,081,899 bp
  • G to A, chromosome 3 at 94,364,350 bp
  • CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT to CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT, chromosome 3 at 95,888,136 bp
  • ACTGGTTCTGTGGTC to ACTGGTTCTGTGGTCTCTGGTTCTGTGGTC, chromosome 3 at 95,888,169 bp
  • T to C, chromosome 3 at 103,310,903 bp
  • G to C, chromosome 3 at 105,986,302 bp
  • C to T, chromosome 3 at 105,986,303 bp
  • T to C, chromosome 3 at 106,014,518 bp
  • G to A, chromosome 3 at 122,246,080 bp
  • C to T, chromosome 4 at 61,303,448 bp
  • A to G, chromosome 4 at 74,145,105 bp
  • T to A, chromosome 4 at 99,955,995 bp
  • A to G, chromosome 4 at 116,975,857 bp
  • A to G, chromosome 4 at 119,136,313 bp
  • T to A, chromosome 5 at 74,003,188 bp
  • A to T, chromosome 5 at 88,663,227 bp
  • C to G, chromosome 5 at 90,295,657 bp
  • T to A, chromosome 5 at 110,829,158 bp
  • T to A, chromosome 5 at 135,736,136 bp
  • A to G, chromosome 6 at 3,708,586 bp
  • T to C, chromosome 6 at 72,342,917 bp
  • A to T, chromosome 6 at 142,248,712 bp
  • A to G, chromosome 7 at 55,900,593 bp
  • G to A, chromosome 7 at 93,080,195 bp
  • A to T, chromosome 7 at 102,973,762 bp
  • A to G, chromosome 7 at 126,489,127 bp
  • T to C, chromosome 7 at 139,582,000 bp
  • A to C, chromosome 8 at 70,780,303 bp
  • T to C, chromosome 8 at 105,891,584 bp
  • A to G, chromosome 8 at 106,108,403 bp
  • A to G, chromosome 8 at 109,948,468 bp
  • T to A, chromosome 8 at 120,674,031 bp
  • T to C, chromosome 9 at 18,815,354 bp
  • G to A, chromosome 9 at 121,763,666 bp
  • G to T, chromosome 10 at 24,711,950 bp
  • A to G, chromosome 10 at 79,381,253 bp
  • T to A, chromosome 10 at 127,706,847 bp
  • C to T, chromosome 11 at 67,205,567 bp
  • C to A, chromosome 11 at 101,423,815 bp
  • T to C, chromosome 11 at 119,846,828 bp
  • T to C, chromosome 12 at 35,133,358 bp
  • T to C, chromosome 12 at 55,845,299 bp
  • T to A, chromosome 12 at 57,658,102 bp
  • C to T, chromosome 12 at 75,933,996 bp
  • T to A, chromosome 12 at 76,040,410 bp
  • G to A, chromosome 13 at 54,795,972 bp
  • A to G, chromosome 13 at 84,282,747 bp
  • C to T, chromosome 14 at 46,780,222 bp
  • T to A, chromosome 14 at 79,619,801 bp
  • G to T, chromosome 15 at 5,099,200 bp
  • A to T, chromosome 15 at 59,369,913 bp
  • A to T, chromosome 15 at 97,688,150 bp
  • T to C, chromosome 17 at 17,387,540 bp
  • G to C, chromosome 17 at 24,364,958 bp
  • T to A, chromosome 17 at 25,321,139 bp
  • T to C, chromosome 17 at 30,706,389 bp
  • T to A, chromosome 17 at 33,019,532 bp
  • T to A, chromosome 17 at 80,049,847 bp
  • T to A, chromosome 18 at 76,288,080 bp
  • A to G, chromosome 19 at 3,892,787 bp
  • A to G, chromosome 19 at 11,557,933 bp
  • T to A, chromosome 19 at 38,141,439 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7430 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045508-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.