Strain Name:
C57BL/6J-MtgxR7430Btlr/Mmmh
Stock Number:
045508-MU
Citation ID:
RRID:MMRRC_045508-MU
Other Names:
R7430 (G1)
Major Collection:

Strain Information

Fgb
Name: fibrinogen beta chain
Synonyms: 2510049G14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 110135
HGNC: HGNC:3662
Homologene: 3772
Rptor
Name: regulatory associated protein of MTOR, complex 1
Synonyms: raptor, 4932417H02Rik, Rap
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74370
Homologene: 80210
Slco1a5
Name: solute carrier organic anion transporter family, member 1a5
Synonyms: Oatp3, Slc21a7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108096
Homologene: 56603
Slc2a1
Name: solute carrier family 2 (facilitated glucose transporter), member 1
Synonyms: Glut-1, Glut1, M100200, Rgsc200
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20525
Homologene: 68520
Plcb4
Name: phospholipase C, beta 4
Synonyms: C230058B11Rik, A930039J07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18798
HGNC: HGNC:9059
Homologene: 8471
Cyfip1
Name: cytoplasmic FMR1 interacting protein 1
Synonyms: P140SRA-1, Shyc, pl-1, l(7)1Rl, Sra-1, E030028J09Rik, l7Rl1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20430
Homologene: 22628
Ankrd17
Name: ankyrin repeat domain 17
Synonyms: 4933425K22Rik, Gtar, A130069E23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 81702
Homologene: 82403
Usp46
Name: ubiquitin specific peptidase 46
Synonyms: 2410018I08Rik, 1190009E20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69727
Homologene: 56957
Cox4i1
Name: cytochrome c oxidase subunit 4I1
Synonyms: Cox4, Cox4a, COXIV
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12857
HGNC: HGNC:2265
Homologene: 37537
Chka
Name: choline kinase alpha
Synonyms: choline/ethanolamine kinase alpha, CK/EK-alpha, ChoK, EtnK-alpha, Chk
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12660
HGNC: HGNC:1937
Homologene: 88575
Hnrnpll
Name: heterogeneous nuclear ribonucleoprotein L-like
Synonyms: 2510028H02Rik, 2810036L13Rik, Hnrpll
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72692
Homologene: 26701
Smad2
Name: SMAD family member 2
Synonyms: Madr2, Smad 2, Madh2, 7120426M23Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17126
HGNC: HGNC:6768
Homologene: 21197
Usf1
Name: upstream transcription factor 1
Synonyms: upstream stimulatory factor, bHLHb11
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22278
Homologene: 31426
Sugt1
Name: SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)
Synonyms: SGT1, 2410174K12Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67955
VEGA: 14
Homologene: 4877
Rpap3
Name: RNA polymerase II associated protein 3
Synonyms: 2310042P20Rik, D15Ertd682e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71919
VEGA: 15
Homologene: 11613
Tmem161b
Name: transmembrane protein 161B
Synonyms: 2810446P07Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72745
Homologene: 14519
Card6
Name: caspase recruitment domain family, member 6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239319
Homologene: 13067
Calcr
Name: calcitonin receptor
Synonyms: Clr
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12311
HGNC: HGNC:1440
Homologene: 1320
Brms1l
Name: breast cancer metastasis-suppressor 1-like
Synonyms: 0710008O11Rik, BRMS1, D12Ertd407e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 52592
VEGA: 12
Homologene: 9123
Sgk3
Name: serum/glucocorticoid regulated kinase 3
Synonyms: fy, cytokine-independent survival kinase, Cisk, 2510015P22Rik, A330005P07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 170755
Homologene: 56582
Cnih1
Name: cornichon family AMPA receptor auxiliary protein 1
Synonyms: Cnih
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12793
Homologene: 4219
Ms4a4d
Name: membrane-spanning 4-domains, subfamily A, member 4D
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66607
Homologene: 113790
Nfatc3
Name: nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 3
Synonyms: NFAT4, NFATx, D8Ertd281e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18021
HGNC: HGNC:7777
Homologene: 27827
Gclm
Name: glutamate-cysteine ligase, modifier subunit
Synonyms: Glclr, Gcmc
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14630
HGNC: HGNC:4312
Homologene: 1557
Usp39
Name: ubiquitin specific peptidase 39
Synonyms: D6Wsu157e, CGI-21, SAD1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28035
Homologene: 13183
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Riok2
Name: RIO kinase 2
Synonyms: 2010110K24Rik, 2410085M17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67045
VEGA: 17
Homologene: 6760
Trim33
Name: tripartite motif-containing 33
Synonyms: Tif1g, 8030451N04Rik, ectodermin, Ecto
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 94093
Homologene: 9296
Edc4
Name: enhancer of mRNA decapping 4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234699
Homologene: 40937
Enpp1
Name: ectonucleotide pyrophosphatase/phosphodiesterase 1
Synonyms: PC-1, NPP1, Ly-41, Npps, Pca-1, Pca, Pdnp1, twy, CD203c, E-NPP1, 4833416E15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18605
HGNC: HGNC:3356
Homologene: 38151
Washc5
Name: WASH complex subunit 5
Synonyms: strumpellin, E430025E21Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223593
VEGA: 15
Homologene: 8898
Fign
Name: fidgetin
Synonyms: Fgn
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 60344
Homologene: 5813
Abca3
Name: ATP-binding cassette, sub-family A member 3
Synonyms: ABC-C, Abc3, 1810036E22Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 27410
HGNC: HGNC:33
Homologene: 37437
Cubn
Name: cubilin
Synonyms: D2Wsu88e, intrinsic factor-cobalamin receptor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65969
HGNC: HGNC:2548
Homologene: 37434
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, Cpfl8, diminished cone electroretinogram, dice
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319565
Homologene: 56700
Snx13
Name: sorting nexin 13
Synonyms: RGS-PX1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217463
VEGA: 12
Homologene: 41011
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
Per2
Name: period circadian clock 2
Synonyms: mPer2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18627
HGNC: HGNC:8846
Homologene: 7885
Mast3
Name: microtubule associated serine/threonine kinase 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 546071
Homologene: 66191
Myh1
Name: myosin, heavy polypeptide 1, skeletal muscle, adult
Synonyms: MyHC-IId/x, Myhs-f, Myhs-f2, Myhsf2, A530084A17Rik, MYHC-IIX, myosin heavy chain 2X, IId, IId/x
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17879
HGNC: HGNC:7567
Homologene: 133718
Vmn2r82
Name: vomeronasal 2, receptor 82
Synonyms: EG624845
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 624845
Homologene: 83483
Lpin3
Name: lipin 3
Synonyms: 9130206L11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 64899
Homologene: 84844
Myo1a
Name: myosin IA
Synonyms: BBM-I, brush border myosin 1, Myhl
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 432516
VEGA: 10
HGNC: HGNC:7595
Homologene: 21113
Postn
Name: periostin, osteoblast specific factor
Synonyms: OSF-2, Periostin, Osf2, peri, A630052E07Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 50706
Homologene: 4730
Pde6c
Name: phosphodiesterase 6C, cGMP specific, cone, alpha prime
Synonyms: cpfl1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 110855
VEGA: 19
HGNC: HGNC:8787
Homologene: 4521
Cimap3
Name: ciliary microtubule associated protein 3
Synonyms: pitchfork, 1700027A23Rik, Pifo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100503311
Homologene: 18759
Tufm
Name: Tu translation elongation factor, mitochondrial
Synonyms: EF-TuMT, 2300002G02Rik, C76308
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233870
Homologene: 2490
BC028528
Name: cDNA sequence BC028528
Synonyms: L259
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229600
Homologene: 49773
Itgav
Name: integrin alpha V
Synonyms: vitronectin receptor alpha polypeptide (VNRA), CD51, alphav-integrin, 1110004F14Rik, 2610028E01Rik, D430040G12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16410
HGNC: HGNC:6150
Homologene: 20510
Zbtb47
Name: zinc finger and BTB domain containing 47
Synonyms: 4732420M22Rik, Zfp651
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270210
VEGA: 9
Homologene: 136302
Tmem120a
Name: transmembrane protein 120A
Synonyms: Tmpit, 2010310D06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 215210
Homologene: 12907
Ovgp1
Name: oviductal glycoprotein 1
Synonyms: MOGP, muc9, mucin 9, oviductin, Chit5, OGP
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12659
HGNC: HGNC:8524
Homologene: 74442
Hscb
Name: HscB iron-sulfur cluster co-chaperone
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100900
Homologene: 13945
Atp8b4
Name: ATPase, class I, type 8B, member 4
Synonyms: Im
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241633
Homologene: 133162
Zswim5
Name: zinc finger SWIM-type containing 5
Synonyms: 4933426E21Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74464
Homologene: 18958
Or7g16
Name: olfactory receptor family 7 subfamily G member 16
Synonyms: GA_x6K02T2PVTD-12559294-12558356, MOR149-1, Olfr828
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258598
HGNC: HGNC:8466
Homologene: 133690
Grsf1
Name: G-rich RNA sequence binding factor 1
Synonyms: D5Wsu31e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231413
HGNC: HGNC:4610
Homologene: 20482
Zfp763
Name: zinc finger protein 763
Synonyms: 1700065O13Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 73451
Homologene: 66274
Pgm1
Name: phosphoglucomutase 1
Synonyms: Pgm-2, 2610020G18Rik, Pgm2, Pgm1a
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72157
HGNC: HGNC:8905
Homologene: 1979
Marveld3
Name: MARVEL (membrane-associating) domain containing 3
Synonyms: MARVD3, 1810006A16Rik, Mrvldc3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 73608
Homologene: 12504
Tspan17
Name: tetraspanin 17
Synonyms: 2210021G21Rik, Fbxo23, Tm4sf17
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 74257
Homologene: 41762
Frmd3
Name: FERM domain containing 3
Synonyms: EPB41L4O, P410, 4.1O, 9430066I12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242506
Homologene: 16012
Ifi204
Name: interferon activated gene 204
Synonyms: p204
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15951
Homologene: 115929
Prss29
Name: serine protease 29
Synonyms: mISP-2, Isp2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 114662
VEGA: 17
Homologene: 70877
Or51g2
Name: olfactory receptor family 51 subfamily G member 2
Synonyms: GA_x6K02T2PBJ9-5685322-5684384, MOR7-2, Olfr577
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259113
Homologene: 64962
C2cd4d
Name: C2 calcium-dependent domain containing 4D
Synonyms: LOC271944, Gm659
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 271944
Homologene: 86310
Nkx6-2
Name: NK6 homeobox 2
Synonyms: Gtx, Nkx6.2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14912
Homologene: 18580
Ttc6
Name: tetratricopeptide repeat domain 6
Synonyms: LOC217602, EG639426, Gm9813, 4921506M07Rik, AU024163
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70846
Homologene: 78002
Loricrin
Name: loricrin cornified envelope precursor protein
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16939
HGNC: HGNC:6663
Ptges3l
Name: prostaglandin E synthase 3 like
Synonyms: 1110069E20Rik, 1700113I22Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 73635
Homologene: 101691
Fam181b
Name: family with sequence similarity 181, member B
Synonyms: A830059I20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 58238
Homologene: 32504
Mup14
Name: major urinary protein 14
Synonyms: Gm13514
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100039116
Homologene: 74304
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 9,872,258 bp
  • C to A, chromosome 1 at 91,423,983 bp
  • T to A, chromosome 1 at 171,417,727 bp
  • C to T, chromosome 1 at 173,755,681 bp
  • G to T, chromosome 2 at 13,322,993 bp
  • T to C, chromosome 2 at 63,979,060 bp
  • T to A, chromosome 2 at 76,810,939 bp
  • G to A, chromosome 2 at 83,794,258 bp
  • A to T, chromosome 2 at 126,403,371 bp
  • T to C, chromosome 2 at 135,968,322 bp
  • A to G, chromosome 2 at 160,898,666 bp
  • T to A, chromosome 3 at 38,887,450 bp
  • A to G, chromosome 3 at 39,009,644 bp
  • T to A, chromosome 3 at 54,370,202 bp
  • C to T, chromosome 3 at 83,046,707 bp
  • C to T, chromosome 3 at 92,081,899 bp
  • G to A, chromosome 3 at 94,364,350 bp
  • CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT to CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT, chromosome 3 at 95,888,136 bp
  • ACTGGTTCTGTGGTC to ACTGGTTCTGTGGTCTCTGGTTCTGTGGTC, chromosome 3 at 95,888,169 bp
  • T to C, chromosome 3 at 103,310,903 bp
  • G to C, chromosome 3 at 105,986,302 bp
  • C to T, chromosome 3 at 105,986,303 bp
  • T to C, chromosome 3 at 106,014,518 bp
  • G to A, chromosome 3 at 122,246,080 bp
  • C to T, chromosome 4 at 61,303,448 bp
  • A to G, chromosome 4 at 74,145,105 bp
  • T to A, chromosome 4 at 99,955,995 bp
  • A to G, chromosome 4 at 116,975,857 bp
  • A to G, chromosome 4 at 119,136,313 bp
  • T to A, chromosome 5 at 74,003,188 bp
  • A to T, chromosome 5 at 88,663,227 bp
  • C to G, chromosome 5 at 90,295,657 bp
  • T to A, chromosome 5 at 110,829,158 bp
  • T to A, chromosome 5 at 135,736,136 bp
  • A to G, chromosome 6 at 3,708,586 bp
  • T to C, chromosome 6 at 72,342,917 bp
  • A to T, chromosome 6 at 142,248,712 bp
  • A to G, chromosome 7 at 55,900,593 bp
  • G to A, chromosome 7 at 93,080,195 bp
  • A to T, chromosome 7 at 102,973,762 bp
  • A to G, chromosome 7 at 126,489,127 bp
  • T to C, chromosome 7 at 139,582,000 bp
  • A to C, chromosome 8 at 70,780,303 bp
  • T to C, chromosome 8 at 105,891,584 bp
  • A to G, chromosome 8 at 106,108,403 bp
  • A to G, chromosome 8 at 109,948,468 bp
  • T to A, chromosome 8 at 120,674,031 bp
  • T to C, chromosome 9 at 18,815,354 bp
  • G to A, chromosome 9 at 121,763,666 bp
  • G to T, chromosome 10 at 24,711,950 bp
  • A to G, chromosome 10 at 79,381,253 bp
  • T to A, chromosome 10 at 127,706,847 bp
  • C to T, chromosome 11 at 67,205,567 bp
  • C to A, chromosome 11 at 101,423,815 bp
  • T to C, chromosome 11 at 119,846,828 bp
  • T to C, chromosome 12 at 35,133,358 bp
  • T to C, chromosome 12 at 55,845,299 bp
  • T to A, chromosome 12 at 57,658,102 bp
  • C to T, chromosome 12 at 75,933,996 bp
  • T to A, chromosome 12 at 76,040,410 bp
  • G to A, chromosome 13 at 54,795,972 bp
  • A to G, chromosome 13 at 84,282,747 bp
  • C to T, chromosome 14 at 46,780,222 bp
  • T to A, chromosome 14 at 79,619,801 bp
  • G to T, chromosome 15 at 5,099,200 bp
  • A to T, chromosome 15 at 59,369,913 bp
  • A to T, chromosome 15 at 97,688,150 bp
  • T to C, chromosome 17 at 17,387,540 bp
  • G to C, chromosome 17 at 24,364,958 bp
  • T to A, chromosome 17 at 25,321,139 bp
  • T to C, chromosome 17 at 30,706,389 bp
  • T to A, chromosome 17 at 33,019,532 bp
  • T to A, chromosome 17 at 80,049,847 bp
  • T to A, chromosome 18 at 76,288,080 bp
  • A to G, chromosome 19 at 3,892,787 bp
  • A to G, chromosome 19 at 11,557,933 bp
  • T to A, chromosome 19 at 38,141,439 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7430 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045508-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.