Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7444Btlr/Mmmh
Stock Number:
045520-MU
Citation ID:
RRID:MMRRC_045520-MU
Other Names:
R7444 (G1)
Major Collection:

Strain Information

Lrig2
Name: leucine-rich repeats and immunoglobulin-like domains 2
Synonyms: 4632419I10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 269473
Homologene: 8882
Epha4
Name: Eph receptor A4
Synonyms: Sek, Sek1, Tyro1, Hek8, Cek8, 2900005C20Rik, rb
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13838
HGNC: HGNC:3388
Homologene: 20933
Atic
Name: 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
Synonyms: 2610509C24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108147
HGNC: HGNC:794
Homologene: 2983
Ptdss2
Name: phosphatidylserine synthase 2
Synonyms: PSS2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27388
Homologene: 8462
Rnf111
Name: ring finger 111
Synonyms: Arkadia
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 93836
VEGA: 9
Homologene: 9741
Rgs12
Name: regulator of G-protein signaling 12
Synonyms: 4632412M04Rik, 1200016K18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71729
HGNC: HGNC:9994
Homologene: 2195
Cep68
Name: centrosomal protein 68
Synonyms: 6030463E10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216543
Homologene: 65235
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 71,563,787 bp
  • A to T, chromosome 1 at 74,747,266 bp
  • A to T, chromosome 1 at 77,387,916 bp
  • A to T, chromosome 1 at 116,292,349 bp
  • A to C, chromosome 1 at 120,241,518 bp
  • G to T, chromosome 1 at 161,046,884 bp
  • C to T, chromosome 2 at 25,243,314 bp
  • ACTTCTTCTTCTTCTTCTTCTTC to ACTTCTTCTTCTTCTTCTTC, chromosome 2 at 58,048,067 bp
  • T to A, chromosome 2 at 87,358,100 bp
  • T to C, chromosome 2 at 89,752,759 bp
  • A to T, chromosome 2 at 112,156,715 bp
  • A to T, chromosome 2 at 113,441,611 bp
  • A to G, chromosome 2 at 122,150,935 bp
  • G to T, chromosome 2 at 130,422,059 bp
  • T to C, chromosome 2 at 131,313,295 bp
  • T to C, chromosome 2 at 140,660,467 bp
  • T to C, chromosome 3 at 93,773,543 bp
  • A to T, chromosome 3 at 104,497,513 bp
  • A to T, chromosome 3 at 138,898,122 bp
  • A to G, chromosome 3 at 145,027,432 bp
  • T to A, chromosome 4 at 116,996,927 bp
  • C to A, chromosome 5 at 23,844,157 bp
  • T to C, chromosome 5 at 35,025,943 bp
  • T to A, chromosome 5 at 83,355,068 bp
  • C to A, chromosome 5 at 108,427,142 bp
  • A to G, chromosome 6 at 29,176,517 bp
  • T to A, chromosome 6 at 41,311,365 bp
  • G to C, chromosome 6 at 85,809,130 bp
  • T to A, chromosome 7 at 6,092,596 bp
  • C to A, chromosome 7 at 6,487,920 bp
  • T to C, chromosome 7 at 19,307,274 bp
  • A to G, chromosome 7 at 33,744,141 bp
  • A to T, chromosome 7 at 48,868,179 bp
  • T to C, chromosome 7 at 107,036,347 bp
  • T to A, chromosome 7 at 107,967,604 bp
  • C to A, chromosome 7 at 141,153,084 bp
  • T to A, chromosome 7 at 141,263,686 bp
  • T to A, chromosome 8 at 33,576,562 bp
  • GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC to GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC, chromosome 8 at 66,860,548 bp
  • C to T, chromosome 8 at 69,135,679 bp
  • T to C, chromosome 9 at 8,946,882 bp
  • A to T, chromosome 9 at 21,245,082 bp
  • A to G, chromosome 9 at 46,298,501 bp
  • T to C, chromosome 9 at 53,548,910 bp
  • T to C, chromosome 9 at 70,440,843 bp
  • T to C, chromosome 10 at 129,311,690 bp
  • A to G, chromosome 11 at 20,239,438 bp
  • G to T, chromosome 11 at 46,166,235 bp
  • A to C, chromosome 11 at 73,244,204 bp
  • T to C, chromosome 11 at 73,983,750 bp
  • A to G, chromosome 12 at 89,510,694 bp
  • T to A, chromosome 12 at 112,605,387 bp
  • T to A, chromosome 12 at 112,781,208 bp
  • T to A, chromosome 13 at 11,555,463 bp
  • C to T, chromosome 13 at 59,727,193 bp
  • T to C, chromosome 13 at 104,249,517 bp
  • A to T, chromosome 14 at 47,251,948 bp
  • A to T, chromosome 14 at 59,423,345 bp
  • A to G, chromosome 14 at 75,283,342 bp
  • T to A, chromosome 16 at 3,715,522 bp
  • T to C, chromosome 17 at 28,878,481 bp
  • T to A, chromosome 17 at 50,047,407 bp
  • T to C, chromosome 18 at 37,309,452 bp
  • T to A, chromosome 18 at 37,422,619 bp
  • G to A, chromosome 18 at 42,101,539 bp
  • A to G, chromosome 19 at 9,007,423 bp
  • A to G, chromosome 19 at 33,558,263 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7444 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045520-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.