Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7455Btlr/Mmmh
Stock Number:
045529-MU
Citation ID:
RRID:MMRRC_045529-MU
Other Names:
R7455 (G1)
Major Collection:

Strain Information

Slc1a2
Name: solute carrier family 1 (glial high affinity glutamate transporter), member 2
Synonyms: GLT1, MGLT1, Eaat2, 1700091C19Rik, GLT-1, 2900019G14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20511
Homologene: 3075
Tlr9
Name: toll-like receptor 9
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 81897
Homologene: 68126
Frem2
Name: Fras1 related extracellular matrix protein 2
Synonyms: 8430406N05Rik, 6030440P17Rik, my, ne, b2b1562Clo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242022
Homologene: 18454
Pmp22
Name: peripheral myelin protein 22
Synonyms: Gas-3, TRE002
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18858
HGNC: HGNC:9118
Homologene: 7482
Phf3
Name: PHD finger protein 3
Synonyms: 2310061N19Rik, AU020177
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213109
HGNC: HGNC:8921
Homologene: 9040
Kdm4b
Name: lysine (K)-specific demethylase 4B
Synonyms: 4732474L06Rik, Jmjd2b
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 193796
Homologene: 27773
Zfp638
Name: zinc finger protein 638
Synonyms: Np220, Zfml
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18139
Homologene: 7447
Sfmbt2
Name: Scm-like with four mbt domains 2
Synonyms: D330030P06Rik, D2Wsu23e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 353282
Homologene: 82485
Tut7
Name: terminal uridylyl transferase 7
Synonyms: 6030448M23Rik, Tent3b, Zcchc6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 214290
VEGA: 13
Homologene: 51941
Fnbp4
Name: formin binding protein 4
Synonyms: FBP30
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 55935
Homologene: 9087
Cad
Name: carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Synonyms: 2410008J01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69719
HGNC: HGNC:1424
Homologene: 1412
Mical3
Name: microtubule associated monooxygenase, calponin and LIM domain containing 3
Synonyms: MICAL-3, C130040D16Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 194401
Homologene: 85288
Akap9
Name: A kinase anchor protein 9
Synonyms: AKAP450, 5730481H23Rik, G1-448-15, repro12, mei2-5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100986
HGNC: HGNC:379
Homologene: 134583
Mcph1
Name: microcephaly, primary autosomal recessive 1
Synonyms: 5430437K10Rik, BRIT1, D030046N04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244329
HGNC: HGNC:6954
Homologene: 32586
Cep68
Name: centrosomal protein 68
Synonyms: 6030463E10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216543
Homologene: 65235
Parg
Name: poly (ADP-ribose) glycohydrolase
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 26430
HGNC: HGNC:8605
Homologene: 50532
Nedd1
Name: neural precursor cell expressed, developmentally down-regulated gene 1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17997
VEGA: 10
HGNC: HGNC:7723
Homologene: 7439
Nectin3
Name: nectin cell adhesion molecule 3
Synonyms: nectin-3, 4921513D19Rik, 2610301B19Rik, 3000002N23Rik, Pvrl3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 58998
Homologene: 9162
Dcc
Name: DCC netrin 1 receptor
Synonyms: C030036D22Rik, Igdcc1, deleted in colorectal carcinoma
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13176
HGNC: HGNC:2701
Homologene: 21081
Avpr1a
Name: arginine vasopressin receptor 1A
Synonyms: V1aR
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 54140
HGNC: HGNC:895
Homologene: 568
Rhpn2
Name: rhophilin, Rho GTPase binding protein 2
Synonyms: 1300002E07Rik, D7Ertd784e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 52428
Homologene: 12407
Asph
Name: aspartate-beta-hydroxylase
Synonyms: cI-37, 2310005F16Rik, aspartyl beta-hydroxylase, calsequestrin-binding protein, Junctin, jumbug, BAH, 3110001L23Rik, junctate
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 65973
HGNC: HGNC:757
Homologene: 20910
Lins1
Name: lines homolog 1
Synonyms: 2700083B01Rik, Wins2, Lins
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72635
Homologene: 10034
Sbsn
Name: suprabasin
Synonyms: 1110005D19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 282619
Homologene: 17900
Zfp534
Name: zinc finger protein 534
Synonyms: Gm13159
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100503584
Homologene: 133076
Cdh23
Name: cadherin related 23 (otocadherin)
Synonyms: 4930542A03Rik, USH1D, mdfw, ahl, bob, nmf112, nmf181, nmf252, sals
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22295
Homologene: 11142
Sox6
Name: SRY (sex determining region Y)-box 6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20679
Homologene: 22631
Tespa1
Name: thymocyte expressed, positive selection associated 1
Synonyms: A430001F24Rik, 5830405N20Rik, Itprid3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67596
VEGA: 10
Homologene: 106645
Tex15
Name: testis expressed gene 15 meiosis and synapsis associated
Synonyms: 2210014E14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 104271
Homologene: 12837
Agbl1
Name: ATP/GTP binding protein-like 1
Synonyms: Nna1-l1, EG244071, Ccp4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244071
Homologene: 17552
Pik3c2g
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18705
HGNC: HGNC:8973
Homologene: 3362
Wdr93
Name: WD repeat domain 93
Synonyms: EG626359
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 626359
Homologene: 56878
Ces2a
Name: carboxylesterase 2A
Synonyms: 9130231C15Rik, Ces6
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102022
HGNC: HGNC:1864
Homologene: 136396
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Cfap44
Name: cilia and flagella associated protein 44
Synonyms: 6330444M21Rik, D16Ertd642e, Wdr52
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 212517
Homologene: 75085
Cfap69
Name: cilia and flagella associated protein 69
Synonyms: A330021E22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 207686
Homologene: 11718
Gm13941
Name: predicted gene 13941
Type: Gene
Species: Mouse
Chromosome: 2
Inpp4b
Name: inositol polyphosphate-4-phosphatase, type II
Synonyms: E130107I17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234515
HGNC: HGNC:6075
Homologene: 20832
Greb1l
Name: growth regulation by estrogen in breast cancer-like
Synonyms: mKIAA4095, AK220484
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 381157
Homologene: 73393
Serpinb10
Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 10
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241197
HGNC: HGNC:8942
Homologene: 68430
Ppfibp1
Name: PTPRF interacting protein, binding protein 1 (liprin beta 1)
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67533
HGNC: HGNC:9249
Homologene: 2685
Zfp110
Name: zinc finger protein 110
Synonyms: NRIF, 2900024E01Rik, Nrif1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 65020
Homologene: 129707
Vmn2r7
Name: vomeronasal 2, receptor 7
Synonyms: 4933425M15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 319217
Homologene: 129754
Mark1
Name: MAP/microtubule affinity regulating kinase 1
Synonyms: Emk3, B930025N23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226778
HGNC: HGNC:6896
Homologene: 49552
Cilp2
Name: cartilage intermediate layer protein 2
Synonyms: CLIP-2, 1110031K21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 68709
Homologene: 17713
Rgl2
Name: ral guanine nucleotide dissociation stimulator-like 2
Synonyms: Rlf, KE1.5, Rab2l, Rgt2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19732
HGNC: HGNC:9769
Homologene: 3494
Or8c8
Name: olfactory receptor family 8 subfamily C member 8
Synonyms: MOR170-6, GA_x6K02T2PVTD-31941084-31942025, K18, Olfr143
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258802
Homologene: 133627
Or7g12
Name: olfactory receptor family 7 subfamily G member 12
Synonyms: GA_x6K02T2PVTD-12724921-12725859, MOR153-2, MOR153-4_p, Olfr834
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258074
HGNC: HGNC:8467
Homologene: 128143
Or4c115
Name: olfactory receptor family 4 subfamily C member 115
Synonyms: GA_x6K02T2Q125-50579531-50578596, MOR233-5, Olfr1220
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258902
Homologene: 74242
Entrep2
Name: endosomal transmembrane epsin interactor 2
Synonyms: 5730507A09Rik, Fam189a1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70638
Homologene: 77705
Ak5
Name: adenylate kinase 5
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229949
HGNC: HGNC:365
Homologene: 76103
Ly9
Name: lymphocyte antigen 9
Synonyms: T100, Lgp100, CD229, SLAMF3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17085
HGNC: HGNC:6730
Homologene: 1759
Scgn
Name: secretagogin, EF-hand calcium binding protein
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 214189
Homologene: 5088
Tmem198
Name: transmembrane protein 198
Synonyms: Tmem198-1, Tmem198a, A230078I05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 319998
Homologene: 44245
Zfp36l2
Name: zinc finger protein 36, C3H type-like 2
Synonyms: Tis11d, ERF2, Brf2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12193
HGNC: HGNC:1108
Homologene: 5027
Ccdc137
Name: coiled-coil domain containing 137
Synonyms: 3110023B02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67291
Homologene: 34992
Cideb
Name: cell death-inducing DNA fragmentation factor, alpha subunit-like effector B
Synonyms: DFFA-like B, 1110030C18Rik, CIDE-B
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12684
HGNC: HGNC:1977
Homologene: 7666
Cysrt1
Name: cysteine rich tail 1
Synonyms: 2310002J15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67859
Homologene: 12200
Cptp
Name: ceramide-1-phosphate transfer protein
Synonyms: Gltpd1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 79554
Homologene: 11550
Boll
Name: boule homolog, RNA binding protein
Synonyms: 4930597B14Rik, 4930554P13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75388
Homologene: 33650
Mup18
Name: major urinary protein 18
Synonyms: Gm12561
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100048884
Homologene: 74304
Nim1k
Name: NIM1 serine/threonine protein kinase
Synonyms: E130304F04Rik, Nim1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 245269
VEGA: 13
Homologene: 25286
Fer1l5
Name: fer-1 like family member 5
Synonyms: 4930533C12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100534273
Homologene: 85232
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 30,837,158 bp
  • A to T, chromosome 1 at 36,388,983 bp
  • T to C, chromosome 1 at 55,300,103 bp
  • G to A, chromosome 1 at 75,479,786 bp
  • A to G, chromosome 1 at 107,536,102 bp
  • A to T, chromosome 1 at 171,593,939 bp
  • T to A, chromosome 1 at 184,919,750 bp
  • G to A, chromosome 2 at 10,577,955 bp
  • A to G, chromosome 2 at 25,239,410 bp
  • G to T, chromosome 2 at 89,097,090 bp
  • ACCACCTCCACCTCCACCTCC to ACCACCTCCACCTCCACCTCCACCTCC, chromosome 2 at 90,777,815 bp
  • A to T, chromosome 2 at 102,735,954 bp
  • A to G, chromosome 2 at 111,094,740 bp
  • T to C, chromosome 2 at 112,728,866 bp
  • C to T, chromosome 3 at 53,572,280 bp
  • T to C, chromosome 3 at 64,716,593 bp
  • C to T, chromosome 3 at 152,481,572 bp
  • A to T, chromosome 4 at 9,531,732 bp
  • A to G, chromosome 4 at 61,673,934 bp
  • G to A, chromosome 4 at 147,674,755 bp
  • G to A, chromosome 4 at 155,866,500 bp
  • T to C, chromosome 5 at 3,972,792 bp
  • T to G, chromosome 5 at 5,625,873 bp
  • C to T, chromosome 5 at 31,074,162 bp
  • G to A, chromosome 6 at 83,930,145 bp
  • T to C, chromosome 6 at 120,958,744 bp
  • T to C, chromosome 6 at 139,967,917 bp
  • T to A, chromosome 6 at 147,016,350 bp
  • A to G, chromosome 7 at 12,848,057 bp
  • A to T, chromosome 7 at 30,753,177 bp
  • G to A, chromosome 7 at 35,371,244 bp
  • A to G, chromosome 7 at 64,759,413 bp
  • C to A, chromosome 7 at 66,711,944 bp
  • C to T, chromosome 7 at 76,424,755 bp
  • A to G, chromosome 7 at 79,775,519 bp
  • T to G, chromosome 7 at 115,489,669 bp
  • T to A, chromosome 8 at 18,631,759 bp
  • T to C, chromosome 8 at 33,576,997 bp
  • A to T, chromosome 8 at 69,881,071 bp
  • T to A, chromosome 8 at 82,071,703 bp
  • T to A, chromosome 8 at 104,737,522 bp
  • A to G, chromosome 9 at 18,988,854 bp
  • T to C, chromosome 9 at 38,254,254 bp
  • A to G, chromosome 9 at 106,224,530 bp
  • T to C, chromosome 10 at 6,830,204 bp
  • A to G, chromosome 10 at 60,306,224 bp
  • A to T, chromosome 10 at 92,700,925 bp
  • T to G, chromosome 10 at 122,449,264 bp
  • A to G, chromosome 10 at 130,360,690 bp
  • T to A, chromosome 11 at 20,230,571 bp
  • A to G, chromosome 11 at 63,134,513 bp
  • T to G, chromosome 11 at 120,460,159 bp
  • G to A, chromosome 13 at 23,966,865 bp
  • T to C, chromosome 13 at 59,822,057 bp
  • G to A, chromosome 13 at 119,712,459 bp
  • T to C, chromosome 14 at 32,209,475 bp
  • T to C, chromosome 14 at 55,754,835 bp
  • A to G, chromosome 16 at 44,404,784 bp
  • A to T, chromosome 16 at 46,496,742 bp
  • G to A, chromosome 17 at 33,932,683 bp
  • T to A, chromosome 17 at 56,396,657 bp
  • A to G, chromosome 17 at 84,187,147 bp
  • G to A, chromosome 18 at 10,554,915 bp
  • A to G, chromosome 18 at 71,420,323 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7455 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045529-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.