Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7455Btlr/Mmmh
Stock Number:
045529-MU
Citation ID:
RRID:MMRRC_045529-MU
Other Names:
R7455 (G1)
Major Collection:

Strain Information

Slc1a2
Name: solute carrier family 1 (glial high affinity glutamate transporter), member 2
Synonyms: GLT1, MGLT1, Eaat2, 1700091C19Rik, GLT-1, 2900019G14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20511
Homologene: 3075
Tlr9
Name: toll-like receptor 9
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 81897
Homologene: 68126
Frem2
Name: Fras1 related extracellular matrix protein 2
Synonyms: 8430406N05Rik, 6030440P17Rik, my, ne, b2b1562Clo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242022
Homologene: 18454
Pmp22
Name: peripheral myelin protein 22
Synonyms: Gas-3, TRE002
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18858
HGNC: HGNC:9118
Homologene: 7482
Phf3
Name: PHD finger protein 3
Synonyms: 2310061N19Rik, AU020177
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213109
HGNC: HGNC:8921
Homologene: 9040
Kdm4b
Name: lysine (K)-specific demethylase 4B
Synonyms: 4732474L06Rik, Jmjd2b
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 193796
Homologene: 27773
Zfp638
Name: zinc finger protein 638
Synonyms: Np220, Zfml
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18139
Homologene: 7447
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 30,837,158 bp
  • A to T, chromosome 1 at 36,388,983 bp
  • T to C, chromosome 1 at 55,300,103 bp
  • G to A, chromosome 1 at 75,479,786 bp
  • A to G, chromosome 1 at 107,536,102 bp
  • A to T, chromosome 1 at 171,593,939 bp
  • T to A, chromosome 1 at 184,919,750 bp
  • G to A, chromosome 2 at 10,577,955 bp
  • A to G, chromosome 2 at 25,239,410 bp
  • G to T, chromosome 2 at 89,097,090 bp
  • ACCACCTCCACCTCCACCTCC to ACCACCTCCACCTCCACCTCCACCTCC, chromosome 2 at 90,777,815 bp
  • A to T, chromosome 2 at 102,735,954 bp
  • A to G, chromosome 2 at 111,094,740 bp
  • T to C, chromosome 2 at 112,728,866 bp
  • C to T, chromosome 3 at 53,572,280 bp
  • T to C, chromosome 3 at 64,716,593 bp
  • C to T, chromosome 3 at 152,481,572 bp
  • A to T, chromosome 4 at 9,531,732 bp
  • A to G, chromosome 4 at 61,673,934 bp
  • G to A, chromosome 4 at 147,674,755 bp
  • G to A, chromosome 4 at 155,866,500 bp
  • T to C, chromosome 5 at 3,972,792 bp
  • T to G, chromosome 5 at 5,625,873 bp
  • C to T, chromosome 5 at 31,074,162 bp
  • G to A, chromosome 6 at 83,930,145 bp
  • T to C, chromosome 6 at 120,958,744 bp
  • T to C, chromosome 6 at 139,967,917 bp
  • T to A, chromosome 6 at 147,016,350 bp
  • A to G, chromosome 7 at 12,848,057 bp
  • A to T, chromosome 7 at 30,753,177 bp
  • G to A, chromosome 7 at 35,371,244 bp
  • A to G, chromosome 7 at 64,759,413 bp
  • C to A, chromosome 7 at 66,711,944 bp
  • C to T, chromosome 7 at 76,424,755 bp
  • A to G, chromosome 7 at 79,775,519 bp
  • T to G, chromosome 7 at 115,489,669 bp
  • T to A, chromosome 8 at 18,631,759 bp
  • T to C, chromosome 8 at 33,576,997 bp
  • A to T, chromosome 8 at 69,881,071 bp
  • T to A, chromosome 8 at 82,071,703 bp
  • T to A, chromosome 8 at 104,737,522 bp
  • A to G, chromosome 9 at 18,988,854 bp
  • T to C, chromosome 9 at 38,254,254 bp
  • A to G, chromosome 9 at 106,224,530 bp
  • T to C, chromosome 10 at 6,830,204 bp
  • A to G, chromosome 10 at 60,306,224 bp
  • A to T, chromosome 10 at 92,700,925 bp
  • T to G, chromosome 10 at 122,449,264 bp
  • A to G, chromosome 10 at 130,360,690 bp
  • T to A, chromosome 11 at 20,230,571 bp
  • A to G, chromosome 11 at 63,134,513 bp
  • T to G, chromosome 11 at 120,460,159 bp
  • G to A, chromosome 13 at 23,966,865 bp
  • T to C, chromosome 13 at 59,822,057 bp
  • G to A, chromosome 13 at 119,712,459 bp
  • T to C, chromosome 14 at 32,209,475 bp
  • T to C, chromosome 14 at 55,754,835 bp
  • A to G, chromosome 16 at 44,404,784 bp
  • A to T, chromosome 16 at 46,496,742 bp
  • G to A, chromosome 17 at 33,932,683 bp
  • T to A, chromosome 17 at 56,396,657 bp
  • A to G, chromosome 17 at 84,187,147 bp
  • G to A, chromosome 18 at 10,554,915 bp
  • A to G, chromosome 18 at 71,420,323 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7455 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045529-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.