Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7474Btlr/Mmmh
Stock Number:
045548-MU
Citation ID:
RRID:MMRRC_045548-MU
Other Names:
R7474 (G1)
Major Collection:

Strain Information

Ext1
Name: exostosin glycosyltransferase 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14042
HGNC: HGNC:3512
Homologene: 30957
Wrn
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22427
Homologene: 6659
Mthfr
Name: methylenetetrahydrofolate reductase
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17769
HGNC: HGNC:7436
Homologene: 4349
Tns3
Name: tensin 3
Synonyms: TEM6, F830010I22Rik, Tens1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 319939
Homologene: 49713
Spats1
Name: spermatogenesis associated, serine-rich 1
Synonyms: 1700011H05Rik, Srsp1, 4933400B06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71020
VEGA: 17
Homologene: 12376
Senp6
Name: SUMO/sentrin specific peptidase 6
Synonyms: E130319N12Rik, 2810017C20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 215351
Homologene: 9196
Vangl1
Name: VANGL planar cell polarity 1
Synonyms: Lpp2, mStbm, stbm, KITENIN
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229658
Homologene: 44540
Rnf2
Name: ring finger protein 2
Synonyms: Ring1B, dinG
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19821
Homologene: 2199
Ptpn21
Name: protein tyrosine phosphatase, non-receptor type 21
Synonyms: PTPD1, PTPRL10
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 24000
VEGA: 12
HGNC: HGNC:9651
Homologene: 5110
Agfg1
Name: ArfGAP with FG repeats 1
Synonyms: Rip, C130049H11Rik, D730048C23Rik, Hrb
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15463
HGNC: HGNC:5175
Homologene: 37929
E2f8
Name: E2F transcription factor 8
Synonyms: 4432406C08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108961
Homologene: 11654
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Klf10
Name: Kruppel-like transcription factor 10
Synonyms: mGIF, Gdnfif, Egral, Tieg1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 21847
VEGA: 15
Homologene: 4135
Rtn1
Name: reticulon 1
Synonyms: Nsp, Rtn1-b, Rtn1-c, 0710005K15Rik, Rtn1-a, 4930441F12Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104001
Homologene: 49654
Mtmr2
Name: myotubularin related protein 2
Synonyms: 6030445P13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 77116
HGNC: HGNC:7450
Homologene: 22951
Apob
Name: apolipoprotein B
Synonyms: apob-100, apob-48
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238055
HGNC: HGNC:603
Homologene: 328
Lamc1
Name: laminin, gamma 1
Synonyms: Lamb2, laminin B2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226519
HGNC: HGNC:6492
Homologene: 1724
Vsir
Name: V-set immunoregulatory receptor
Synonyms: VISTA, Dies1, PD-1H, 4632428N05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74048
Homologene: 81923
Gcnt2
Name: glucosaminyl (N-acetyl) transferase 2 (I blood group)
Synonyms: IGnTC, IGnTB, IGnTA, 5330430K10Rik, IGnT
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14538
VEGA: 13
HGNC: HGNC:4204
Homologene: 41535
Extl3
Name: exostosin-like glycosyltransferase 3
Synonyms: 2900009G18Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 54616
VEGA: 14
HGNC: HGNC:3518
Homologene: 1103
Amotl2
Name: angiomotin-like 2
Synonyms: Lccp, MASCOT
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56332
Homologene: 9420
Vac14
Name: Vac14 homolog (S. cerevisiae)
Synonyms: Trx, Tax1bp2, D8Wsu151e, ingls
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234729
Homologene: 6528
Uxs1
Name: UDP-glucuronate decarboxylase 1
Synonyms: 1600025I13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67883
Homologene: 41609
Gtf3c2
Name: general transcription factor IIIC, polypeptide 2, beta
Synonyms: 2610510G03Rik, TFIIIC-BETA, TFIIIC110, 1300004C11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71752
HGNC: HGNC:4665
Homologene: 37490
Prickle1
Name: prickle planar cell polarity protein 1
Synonyms: 1110058P22Rik, mpk1, b2b019Clo, Pk1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 106042
Homologene: 17686
Abca13
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268379
Homologene: 27991
Atp10a
Name: ATPase, class V, type 10A
Synonyms: pfatp, Atp10c
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11982
Homologene: 56461
Insc
Name: INSC spindle orientation adaptor protein
Synonyms: Inscuteable, 3830422K02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233752
Homologene: 78662
Tnfsf14
Name: tumor necrosis factor (ligand) superfamily, member 14
Synonyms: LIGHT, HVEM-L
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 50930
VEGA: 17
Homologene: 2822
Sorcs1
Name: sortilin-related VPS10 domain containing receptor 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 58178
Homologene: 10967
Myh13
Name: myosin, heavy polypeptide 13, skeletal muscle
Synonyms: extraocular myosin, EO Myosin, MyHC-eo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 544791
HGNC: HGNC:7571
Homologene: 55780
Kctd19
Name: potassium channel tetramerisation domain containing 19
Synonyms: 4922504H04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 279499
Homologene: 18630
Agfg2
Name: ArfGAP with FG repeats 2
Synonyms: A630095P14Rik, Hrbl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231801
HGNC: HGNC:5177
Homologene: 4430
Dscam
Name: DS cell adhesion molecule
Synonyms: 4932410A21Rik, Down syndrome cell adhesion molecule
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13508
HGNC: HGNC:3039
Homologene: 74393
Gm5114
Name: predicted gene 5114
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330513
Homologene: 45597
Or6d13
Name: olfactory receptor family 6 subfamily D member 13
Synonyms: GA_x54KRFPKN04-58174409-58175392, MOR119-3, Olfr213
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258020
Homologene: 74186
Vwce
Name: von Willebrand factor C and EGF domains
Synonyms: 1300015B04Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71768
VEGA: 19
Homologene: 17651
Or14j10
Name: olfactory receptor family 14 subfamily J member 10
Synonyms: MOR218-2, GA_x6K02T2PSCP-2084102-2083137, Olfr116
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258625
Crxos
Name: cone-rod homeobox, opposite strand
Synonyms: Egam1, Crxos1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 546024
Homologene: 136482
L3mbtl1
Name: L3MBTL1 histone methyl-lysine binding protein
Synonyms: L3MBTL1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241764
Homologene: 41846
Rnpepl1
Name: arginyl aminopeptidase (aminopeptidase B)-like 1
Synonyms: 1110014H17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108657
Homologene: 36367
Slco2b1
Name: solute carrier organic anion transporter family, member 2b1
Synonyms: OATP-B, Slc21a9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101488
Homologene: 21419
Smgc
Name: submandibular gland protein C
Synonyms: Sfc21, 2310010P21Rik, DXImx49e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223809
Mdga2
Name: MAM domain containing glycosylphosphatidylinositol anchor 2
Synonyms: Mdga2, 9330209L04Rik, 6720489L24Rik, Mamdc1, Adp
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320772
Homologene: 45659
Csmd2
Name: CUB and Sushi multiple domains 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329942
Homologene: 89034
Pla2g4a
Name: phospholipase A2, group IVA (cytosolic, calcium-dependent)
Synonyms: cPLA2, Type IV PLA2, cytosolic PLA2, cPLA2alpha, cytosolic phospholipase A2, Pla2g4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18783
HGNC: HGNC:9035
Homologene: 32059
Zfp735
Name: zinc finger protein 735
Synonyms: 1700012C15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76390
Homologene: 88945
Mak
Name: male germ cell-associated kinase
Synonyms: A930010O05Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17152
VEGA: 13
HGNC: HGNC:6816
Homologene: 31344
Or8i2
Name: olfactory receptor family 8 subfamily I member 2
Synonyms: GA_x6K02T2Q125-48508763-48507833, MOR207-1, Olfr1104
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258763
Homologene: 64916
Nrg3
Name: neuregulin 3
Synonyms: ska
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18183
HGNC: HGNC:7999
Homologene: 32051
Fsd1
Name: fibronectin type 3 and SPRY domain-containing protein
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240121
VEGA: 17
Homologene: 11531
Ncan
Name: neurocan
Synonyms: Tgfbit, Cspg3, Cspg3-rs
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13004
HGNC: HGNC:2465
Homologene: 3229
Kcnt2
Name: potassium channel, subfamily T, member 2
Synonyms: E330038N15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240776
Homologene: 16121
Pramel26
Name: PRAME like 26
Synonyms: Gm13084
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381569
Homologene: 77858
Abcc1
Name: ATP-binding cassette, sub-family C member 1
Synonyms: MRP, Mdrap, Mrp1, Abcc1b, Abcc1a
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17250
HGNC: HGNC:51
Homologene: 133779
Lrrc63
Name: leucine rich repeat containing 63
Synonyms: 4921509B22Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70859
Homologene: 52823
Olfml2a
Name: olfactomedin-like 2A
Synonyms: 4932431K08Rik, photomedin-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241327
Homologene: 35248
Asb18
Name: ankyrin repeat and SOCS box-containing 18
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 208372
Homologene: 16382
Cyp2c67
Name: cytochrome P450, family 2, subfamily c, polypeptide 67
Synonyms: C730004C24Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 545288
HGNC: HGNC:2622
Homologene: 74936
Aup1
Name: ancient ubiquitous protein 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11993
HGNC: HGNC:891
Homologene: 7239
Gm10309
Name: predicted gene 10309
Type: Gene
Species: Mouse
Chromosome: 17
Nans
Name: N-acetylneuraminic acid synthase (sialic acid synthase)
Synonyms: N-acetylneuraminic acid phosphate synthase, Sas, 4632418E04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 94181
Homologene: 10343
Blvra
Name: biliverdin reductase A
Synonyms: Blvr, 2500001N03Rik, 0610006A11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 109778
HGNC: HGNC:1062
Homologene: 572
Pstk
Name: phosphoseryl-tRNA kinase
Synonyms: 5430423O14Rik, LOC381976, 5730458D16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 214580
Homologene: 45167
Or52e19b
Name: olfactory receptor family 52 subfamily E member 19B
Synonyms: GA_x6K02T2PBJ9-6096387-6095449, GA_x6K02T2PBJ9-6092550-6092362, MOR32-2, MOR32-14_i, Olfr604, Olfr603
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259073
Homologene: 121535
Cd300c2
Name: CD300C molecule 2
Synonyms: DIgR1, Clm4, LMIR2, Igsf7, Cd300d, MAIR-II, AF251705
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 140497
Homologene: 74580
Cabp4
Name: calcium binding protein 4
Synonyms: 2410038D05Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73660
VEGA: 19
HGNC: HGNC:1386
Homologene: 16927
Or51v15-ps1
Name: olfactory receptor family 51 subfamily V member 15, pseudogene 1
Synonyms: GA_x6K02T2PBJ9-6352653-6351709, MOR4-3P, MOR4-4_p, EG667639, Olfr621-ps1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 667639
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 43,757,024 bp
  • A to C, chromosome 1 at 75,498,184 bp
  • T to A, chromosome 1 at 82,882,411 bp
  • T to A, chromosome 1 at 89,993,033 bp
  • T to C, chromosome 1 at 92,918,972 bp
  • T to C, chromosome 1 at 140,570,478 bp
  • T to C, chromosome 1 at 149,865,200 bp
  • T to A, chromosome 1 at 151,471,716 bp
  • G to A, chromosome 1 at 153,332,265 bp
  • CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC to CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC, chromosome 1 at 174,609,203 bp
  • T to C, chromosome 2 at 38,960,261 bp
  • T to C, chromosome 2 at 87,022,554 bp
  • T to C, chromosome 2 at 127,086,849 bp
  • A to T, chromosome 2 at 162,966,604 bp
  • A to T, chromosome 2 at 177,202,825 bp
  • A to G, chromosome 3 at 102,184,249 bp
  • T to A, chromosome 4 at 46,502,484 bp
  • A to G, chromosome 4 at 128,546,127 bp
  • T to C, chromosome 4 at 143,811,699 bp
  • T to A, chromosome 4 at 148,052,602 bp
  • C to A, chromosome 5 at 31,167,756 bp
  • C to A, chromosome 5 at 137,653,868 bp
  • T to C, chromosome 6 at 83,054,967 bp
  • G to T, chromosome 6 at 116,541,038 bp
  • A to G, chromosome 7 at 15,902,931 bp
  • A to T, chromosome 7 at 39,407,980 bp
  • T to A, chromosome 7 at 42,476,254 bp
  • G to A, chromosome 7 at 48,875,760 bp
  • G to A, chromosome 7 at 58,658,527 bp
  • A to T, chromosome 7 at 99,664,832 bp
  • A to G, chromosome 7 at 103,383,762 bp
  • C to A, chromosome 7 at 103,629,147 bp
  • G to A, chromosome 7 at 114,768,823 bp
  • A to G, chromosome 7 at 131,373,633 bp
  • A to T, chromosome 8 at 33,329,181 bp
  • C to A, chromosome 8 at 70,102,041 bp
  • C to A, chromosome 8 at 105,392,032 bp
  • T to A, chromosome 8 at 110,636,434 bp
  • C to A, chromosome 9 at 13,799,225 bp
  • T to C, chromosome 9 at 80,142,328 bp
  • T to C, chromosome 9 at 102,730,111 bp
  • A to G, chromosome 10 at 60,368,922 bp
  • T to C, chromosome 11 at 8,530,894 bp
  • T to A, chromosome 11 at 9,328,088 bp
  • A to T, chromosome 11 at 67,327,164 bp
  • A to C, chromosome 11 at 67,367,711 bp
  • A to T, chromosome 11 at 73,711,176 bp
  • T to A, chromosome 11 at 114,998,296 bp
  • A to T, chromosome 12 at 8,009,185 bp
  • G to A, chromosome 12 at 66,486,761 bp
  • C to T, chromosome 12 at 72,308,390 bp
  • A to G, chromosome 12 at 98,737,363 bp
  • A to G, chromosome 13 at 11,594,876 bp
  • T to A, chromosome 13 at 40,958,257 bp
  • T to A, chromosome 13 at 41,051,480 bp
  • T to C, chromosome 14 at 39,011,999 bp
  • T to G, chromosome 14 at 61,211,178 bp
  • T to C, chromosome 14 at 65,076,641 bp
  • T to A, chromosome 14 at 75,126,203 bp
  • T to C, chromosome 15 at 38,297,202 bp
  • A to T, chromosome 15 at 53,344,489 bp
  • T to A, chromosome 15 at 91,860,694 bp
  • A to T, chromosome 15 at 93,508,671 bp
  • A to G, chromosome 16 at 14,472,986 bp
  • T to A, chromosome 16 at 96,819,889 bp
  • T to C, chromosome 17 at 37,624,386 bp
  • A to G, chromosome 17 at 45,457,161 bp
  • A to T, chromosome 17 at 55,988,149 bp
  • T to A, chromosome 17 at 57,190,848 bp
  • A to G, chromosome 17 at 57,299,102 bp
  • G to A, chromosome 17 at 86,504,667 bp
  • T to C, chromosome 19 at 4,139,399 bp
  • T to A, chromosome 19 at 10,646,941 bp
  • T to A, chromosome 19 at 39,617,432 bp
  • T to C, chromosome 19 at 50,153,112 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7474 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045548-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.