Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7474Btlr/Mmmh
Stock Number:
045548-MU
Citation ID:
RRID:MMRRC_045548-MU
Other Names:
R7474 (G1)
Major Collection:

Strain Information

Ext1
Name: exostosin glycosyltransferase 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14042
HGNC: HGNC:3512
Homologene: 30957
Wrn
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22427
Homologene: 6659
Mthfr
Name: methylenetetrahydrofolate reductase
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17769
HGNC: HGNC:7436
Homologene: 4349
Tns3
Name: tensin 3
Synonyms: TEM6, F830010I22Rik, Tens1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 319939
Homologene: 49713
Spats1
Name: spermatogenesis associated, serine-rich 1
Synonyms: 1700011H05Rik, Srsp1, 4933400B06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71020
VEGA: 17
Homologene: 12376
Senp6
Name: SUMO/sentrin specific peptidase 6
Synonyms: E130319N12Rik, 2810017C20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 215351
Homologene: 9196
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 43,757,024 bp
  • A to C, chromosome 1 at 75,498,184 bp
  • T to A, chromosome 1 at 82,882,411 bp
  • T to A, chromosome 1 at 89,993,033 bp
  • T to C, chromosome 1 at 92,918,972 bp
  • T to C, chromosome 1 at 140,570,478 bp
  • T to C, chromosome 1 at 149,865,200 bp
  • T to A, chromosome 1 at 151,471,716 bp
  • G to A, chromosome 1 at 153,332,265 bp
  • CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC to CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC, chromosome 1 at 174,609,203 bp
  • T to C, chromosome 2 at 38,960,261 bp
  • T to C, chromosome 2 at 87,022,554 bp
  • T to C, chromosome 2 at 127,086,849 bp
  • A to T, chromosome 2 at 162,966,604 bp
  • A to T, chromosome 2 at 177,202,825 bp
  • A to G, chromosome 3 at 102,184,249 bp
  • T to A, chromosome 4 at 46,502,484 bp
  • A to G, chromosome 4 at 128,546,127 bp
  • T to C, chromosome 4 at 143,811,699 bp
  • T to A, chromosome 4 at 148,052,602 bp
  • C to A, chromosome 5 at 31,167,756 bp
  • C to A, chromosome 5 at 137,653,868 bp
  • T to C, chromosome 6 at 83,054,967 bp
  • G to T, chromosome 6 at 116,541,038 bp
  • A to G, chromosome 7 at 15,902,931 bp
  • A to T, chromosome 7 at 39,407,980 bp
  • T to A, chromosome 7 at 42,476,254 bp
  • G to A, chromosome 7 at 48,875,760 bp
  • G to A, chromosome 7 at 58,658,527 bp
  • A to T, chromosome 7 at 99,664,832 bp
  • A to G, chromosome 7 at 103,383,762 bp
  • C to A, chromosome 7 at 103,629,147 bp
  • G to A, chromosome 7 at 114,768,823 bp
  • A to G, chromosome 7 at 131,373,633 bp
  • A to T, chromosome 8 at 33,329,181 bp
  • C to A, chromosome 8 at 70,102,041 bp
  • C to A, chromosome 8 at 105,392,032 bp
  • T to A, chromosome 8 at 110,636,434 bp
  • C to A, chromosome 9 at 13,799,225 bp
  • T to C, chromosome 9 at 80,142,328 bp
  • T to C, chromosome 9 at 102,730,111 bp
  • A to G, chromosome 10 at 60,368,922 bp
  • T to C, chromosome 11 at 8,530,894 bp
  • T to A, chromosome 11 at 9,328,088 bp
  • A to T, chromosome 11 at 67,327,164 bp
  • A to C, chromosome 11 at 67,367,711 bp
  • A to T, chromosome 11 at 73,711,176 bp
  • T to A, chromosome 11 at 114,998,296 bp
  • A to T, chromosome 12 at 8,009,185 bp
  • G to A, chromosome 12 at 66,486,761 bp
  • C to T, chromosome 12 at 72,308,390 bp
  • A to G, chromosome 12 at 98,737,363 bp
  • A to G, chromosome 13 at 11,594,876 bp
  • T to A, chromosome 13 at 40,958,257 bp
  • T to A, chromosome 13 at 41,051,480 bp
  • T to C, chromosome 14 at 39,011,999 bp
  • T to G, chromosome 14 at 61,211,178 bp
  • T to C, chromosome 14 at 65,076,641 bp
  • T to A, chromosome 14 at 75,126,203 bp
  • T to C, chromosome 15 at 38,297,202 bp
  • A to T, chromosome 15 at 53,344,489 bp
  • T to A, chromosome 15 at 91,860,694 bp
  • A to T, chromosome 15 at 93,508,671 bp
  • A to G, chromosome 16 at 14,472,986 bp
  • T to A, chromosome 16 at 96,819,889 bp
  • T to C, chromosome 17 at 37,624,386 bp
  • A to G, chromosome 17 at 45,457,161 bp
  • A to T, chromosome 17 at 55,988,149 bp
  • T to A, chromosome 17 at 57,190,848 bp
  • A to G, chromosome 17 at 57,299,102 bp
  • G to A, chromosome 17 at 86,504,667 bp
  • T to C, chromosome 19 at 4,139,399 bp
  • T to A, chromosome 19 at 10,646,941 bp
  • T to A, chromosome 19 at 39,617,432 bp
  • T to C, chromosome 19 at 50,153,112 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7474 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045548-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.