Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7475Btlr/Mmmh
Stock Number:
045549-MU
Citation ID:
RRID:MMRRC_045549-MU
Other Names:
R7475 (G1)
Major Collection:

Strain Information

Ifngr2
Name: interferon gamma receptor 2
Synonyms: Ifgt, Ifgr2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15980
HGNC: HGNC:5440
Homologene: 4041
Septin3
Name: septin 3
Synonyms: Sep3, B530002E20Rik, 3110018K01Rik, Gm46500, Sept3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 24050
VEGA: 15
Homologene: 99740
Jmjd1c
Name: jumonji domain containing 1C
Synonyms: TRIP8, 5430433L24Rik, D630035I23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 108829
Homologene: 3129
Foxj2
Name: forkhead box J2
Synonyms: Fhx
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 60611
Homologene: 10187
Nlk
Name: nemo like kinase
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18099
Homologene: 88836
Gria4
Name: glutamate receptor, ionotropic, AMPA4 (alpha 4)
Synonyms: Glur-4, Glur4, spkw1, Gluralpha4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14802
HGNC: HGNC:4574
Homologene: 20227
Usp46
Name: ubiquitin specific peptidase 46
Synonyms: 2410018I08Rik, 1190009E20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69727
Homologene: 56957
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 82,745,438 bp
  • T to C, chromosome 1 at 87,760,083 bp
  • C to A, chromosome 1 at 171,340,313 bp
  • T to C, chromosome 2 at 30,087,110 bp
  • T to C, chromosome 2 at 41,344,576 bp
  • A to T, chromosome 2 at 55,437,326 bp
  • A to G, chromosome 2 at 88,643,210 bp
  • T to C, chromosome 2 at 117,286,108 bp
  • A to T, chromosome 2 at 119,087,546 bp
  • A to G, chromosome 2 at 120,688,110 bp
  • A to T, chromosome 2 at 120,748,640 bp
  • T to C, chromosome 2 at 146,891,086 bp
  • C to T, chromosome 2 at 152,105,653 bp
  • T to C, chromosome 3 at 96,715,185 bp
  • A to G, chromosome 3 at 142,501,361 bp
  • T to C, chromosome 4 at 106,342,353 bp
  • T to A, chromosome 5 at 74,028,937 bp
  • A to T, chromosome 5 at 120,817,640 bp
  • T to A, chromosome 5 at 121,358,133 bp
  • T to A, chromosome 5 at 134,201,426 bp
  • T to C, chromosome 5 at 140,744,186 bp
  • T to A, chromosome 5 at 150,049,581 bp
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp
  • G to A, chromosome 6 at 48,455,860 bp
  • T to A, chromosome 6 at 82,914,374 bp
  • A to G, chromosome 6 at 122,837,842 bp
  • T to C, chromosome 7 at 4,851,085 bp
  • T to G, chromosome 7 at 12,906,737 bp
  • C to T, chromosome 7 at 28,102,976 bp
  • A to G, chromosome 7 at 46,267,276 bp
  • T to A, chromosome 7 at 47,589,947 bp
  • A to T, chromosome 7 at 65,322,339 bp
  • T to C, chromosome 7 at 81,023,452 bp
  • A to T, chromosome 7 at 128,107,982 bp
  • A to T, chromosome 7 at 131,392,059 bp
  • A to G, chromosome 7 at 141,210,689 bp
  • G to T, chromosome 8 at 23,132,630 bp
  • C to T, chromosome 8 at 34,831,712 bp
  • A to G, chromosome 8 at 72,749,872 bp
  • T to A, chromosome 8 at 105,053,690 bp
  • T to C, chromosome 8 at 124,434,011 bp
  • T to G, chromosome 9 at 4,513,330 bp
  • C to T, chromosome 9 at 37,425,378 bp
  • A to G, chromosome 9 at 39,597,940 bp
  • T to A, chromosome 9 at 45,927,625 bp
  • T to A, chromosome 9 at 48,393,340 bp
  • A to T, chromosome 9 at 48,592,232 bp
  • C to T, chromosome 9 at 96,856,367 bp
  • T to A, chromosome 10 at 39,158,300 bp
  • C to T, chromosome 10 at 43,021,834 bp
  • T to G, chromosome 10 at 67,225,313 bp
  • T to A, chromosome 10 at 75,246,447 bp
  • T to C, chromosome 11 at 32,711,999 bp
  • T to C, chromosome 11 at 51,713,552 bp
  • C to A, chromosome 11 at 55,303,653 bp
  • T to C, chromosome 11 at 70,461,041 bp
  • C to A, chromosome 11 at 78,583,399 bp
  • A to T, chromosome 13 at 4,576,319 bp
  • A to G, chromosome 13 at 22,178,772 bp
  • A to C, chromosome 13 at 33,093,565 bp
  • T to C, chromosome 13 at 73,825,742 bp
  • T to A, chromosome 14 at 56,026,943 bp
  • G to T, chromosome 14 at 65,026,465 bp
  • A to T, chromosome 15 at 10,409,537 bp
  • C to T, chromosome 15 at 44,505,185 bp
  • T to C, chromosome 15 at 82,286,456 bp
  • A to T, chromosome 15 at 99,947,514 bp
  • G to T, chromosome 16 at 20,399,989 bp
  • A to G, chromosome 16 at 31,881,938 bp
  • G to A, chromosome 16 at 34,914,076 bp
  • G to A, chromosome 16 at 91,557,909 bp
  • A to G, chromosome 17 at 11,434,614 bp
  • A to G, chromosome 17 at 35,963,567 bp
  • A to G, chromosome 17 at 66,087,537 bp
  • G to T, chromosome 17 at 88,555,603 bp
  • T to C, chromosome 18 at 32,199,962 bp
  • G to T, chromosome 18 at 44,476,236 bp
  • C to A, chromosome 18 at 77,412,305 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7475 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045549-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.