Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7481Btlr/Mmmh
Stock Number:
045555-MU
Citation ID:
RRID:MMRRC_045555-MU
Other Names:
R7481 (G1)
Major Collection:

Strain Information

Pank4
Name: pantothenate kinase 4
Synonyms: D030031I12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269614
Homologene: 41235
Glrx3
Name: glutaredoxin 3
Synonyms: PKC interacting cousin of thioredoxin, PICOT, Txnl2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 30926
Homologene: 4769
Wdr82
Name: WD repeat domain containing 82
Synonyms: 9430077D24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 77305
Homologene: 42951
Jade1
Name: jade family PHD finger 1
Synonyms: D530048A03Rik, Phf17
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 269424
Homologene: 18162
Sec24d
Name: SEC24 homolog D, COPII coat complex component
Synonyms: 2310020L09Rik, LOC383951
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69608
Homologene: 40986
Zfat
Name: zinc finger and AT hook domain containing
Synonyms: LOC380993, Zfp406, Zfat1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 380993
Homologene: 16829
Sbno2
Name: strawberry notch 2
Synonyms: Stno
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216161
VEGA: 10
Homologene: 8981
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 24,317,707 bp
  • A to C, chromosome 1 at 74,419,899 bp
  • A to G, chromosome 1 at 75,173,604 bp
  • A to T, chromosome 1 at 151,808,222 bp
  • G to A, chromosome 1 at 151,808,223 bp
  • A to T, chromosome 2 at 21,211,788 bp
  • G to A, chromosome 2 at 24,616,862 bp
  • A to T, chromosome 2 at 37,600,754 bp
  • A to G, chromosome 2 at 53,108,431 bp
  • T to C, chromosome 2 at 68,664,231 bp
  • A to G, chromosome 2 at 88,149,761 bp
  • C to T, chromosome 2 at 89,494,292 bp
  • C to A, chromosome 2 at 112,678,093 bp
  • C to A, chromosome 2 at 112,678,094 bp
  • T to A, chromosome 2 at 150,239,346 bp
  • A to T, chromosome 3 at 14,863,572 bp
  • G to A, chromosome 3 at 41,604,690 bp
  • T to C, chromosome 3 at 123,350,763 bp
  • A to G, chromosome 4 at 44,994,905 bp
  • T to C, chromosome 4 at 70,433,442 bp
  • A to G, chromosome 4 at 154,970,038 bp
  • GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT, chromosome 5 at 113,819,695 bp
  • T to A, chromosome 5 at 135,636,177 bp
  • G to A, chromosome 6 at 82,760,169 bp
  • G to A, chromosome 6 at 122,928,039 bp
  • G to A, chromosome 6 at 124,517,725 bp
  • G to A, chromosome 6 at 146,818,871 bp
  • A to T, chromosome 7 at 7,384,580 bp
  • A to T, chromosome 7 at 83,882,338 bp
  • CGGCGGCGG to CGGCGGCGGGGGCGGCGG, chromosome 7 at 97,579,917 bp
  • A to T, chromosome 7 at 99,269,138 bp
  • C to T, chromosome 7 at 127,393,324 bp
  • A to T, chromosome 7 at 131,079,511 bp
  • T to C, chromosome 7 at 137,445,022 bp
  • C to T, chromosome 7 at 141,861,171 bp
  • CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,817 bp
  • T to C, chromosome 8 at 27,156,581 bp
  • T to A, chromosome 8 at 41,084,615 bp
  • T to C, chromosome 8 at 54,661,336 bp
  • C to T, chromosome 8 at 90,956,438 bp
  • C to T, chromosome 8 at 107,072,721 bp
  • C to T, chromosome 9 at 21,062,607 bp
  • T to C, chromosome 9 at 44,809,071 bp
  • A to T, chromosome 9 at 86,535,932 bp
  • C to T, chromosome 9 at 106,176,666 bp
  • G to T, chromosome 10 at 29,196,523 bp
  • A to G, chromosome 10 at 41,230,005 bp
  • A to T, chromosome 10 at 80,022,300 bp
  • G to A, chromosome 10 at 80,057,499 bp
  • C to T, chromosome 10 at 127,007,591 bp
  • G to A, chromosome 11 at 90,594,813 bp
  • A to G, chromosome 11 at 96,154,846 bp
  • A to G, chromosome 12 at 13,356,959 bp
  • T to A, chromosome 12 at 70,887,055 bp
  • A to G, chromosome 12 at 72,155,624 bp
  • A to C, chromosome 12 at 83,331,927 bp
  • G to A, chromosome 14 at 72,482,676 bp
  • A to G, chromosome 15 at 4,814,875 bp
  • A to T, chromosome 15 at 9,113,817 bp
  • A to G, chromosome 15 at 44,512,911 bp
  • G to A, chromosome 15 at 68,178,866 bp
  • C to A, chromosome 17 at 8,949,430 bp
  • T to A, chromosome 17 at 37,835,398 bp
  • C to A, chromosome 17 at 57,220,136 bp
  • A to G, chromosome 18 at 37,727,937 bp
  • A to T, chromosome 18 at 78,349,793 bp
  • A to G, chromosome 19 at 3,964,549 bp
  • A to T, chromosome 19 at 13,530,453 bp
  • G to T, chromosome Y at 1,432,180 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7481 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045555-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.