Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7481Btlr/Mmmh
Stock Number:
045555-MU
Citation ID:
RRID:MMRRC_045555-MU
Other Names:
R7481 (G1)
Major Collection:

Strain Information

Pank4
Name: pantothenate kinase 4
Synonyms: D030031I12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269614
Homologene: 41235
Glrx3
Name: glutaredoxin 3
Synonyms: PKC interacting cousin of thioredoxin, PICOT, Txnl2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 30926
Homologene: 4769
Wdr82
Name: WD repeat domain containing 82
Synonyms: 9430077D24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 77305
Homologene: 42951
Jade1
Name: jade family PHD finger 1
Synonyms: D530048A03Rik, Phf17
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 269424
Homologene: 18162
Sec24d
Name: SEC24 homolog D, COPII coat complex component
Synonyms: 2310020L09Rik, LOC383951
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69608
Homologene: 40986
Zfat
Name: zinc finger and AT hook domain containing
Synonyms: LOC380993, Zfp406, Zfat1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 380993
Homologene: 16829
Sbno2
Name: strawberry notch 2
Synonyms: Stno
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216161
VEGA: 10
Homologene: 8981
Chd9
Name: chromodomain helicase DNA binding protein 9
Synonyms: 1810014J18Rik, AD013, A330063D19Rik, 9030205D12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 109151
Homologene: 11844
Kmt2a
Name: lysine (K)-specific methyltransferase 2A
Synonyms: trithorax Drosophila, HTRX1, ALL-1, All1, Cxxc7, Mll, Mll1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214162
HGNC: HGNC:7132
Homologene: 4338
Dop1a
Name: DOP1 leucine zipper like protein A
Synonyms: B130005I07Rik, D9Ertd809e, Dopey1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320615
Homologene: 26645
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Skp2
Name: S-phase kinase-associated protein 2
Synonyms: FBXL1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 27401
Homologene: 55942
Hk2
Name: hexokinase 2
Synonyms: HKII
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15277
HGNC: HGNC:4923
Homologene: 37273
Dmbt1
Name: deleted in malignant brain tumors 1
Synonyms: CRP-[b], CRP-[a], ebnerin, hensin, vomeroglandin, Crpd, MUCLIN, gp300
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12945
HGNC: HGNC:2926
Homologene: 68990
C6
Name: complement component 6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12274
HGNC: HGNC:1339
Homologene: 47
C3
Name: complement component 3
Synonyms: complement factor 3, acylation stimulating protein, Plp
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12266
HGNC: HGNC:1318
Homologene: 68031
Megf9
Name: multiple EGF-like-domains 9
Synonyms: 4933405H16Rik, Egfl5
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230316
HGNC: HGNC:3234
Homologene: 18209
Edem3
Name: ER degradation enhancer, mannosidase alpha-like 3
Synonyms: 2310050N11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66967
Homologene: 11866
Fmnl2
Name: formin-like 2
Synonyms: 5430425K04Rik, man
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71409
Homologene: 70871
Mtus1
Name: mitochondrial tumor suppressor 1
Synonyms: MD44, MTSG1, Atip1, B430305I03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102103
Homologene: 100292
Frmd6
Name: FERM domain containing 6
Synonyms: 2610019M19Rik, 4930488L10Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319710
VEGA: 12
Homologene: 12449
Car3
Name: carbonic anhydrase 3
Synonyms: Car-3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12350
HGNC: HGNC:1374
Homologene: 31298
Nbas
Name: neuroblastoma amplified sequence
Synonyms: 4933425L03Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 71169
VEGA: 12
Homologene: 41073
Strbp
Name: spermatid perinuclear RNA binding protein
Synonyms: Spnr, 6430510M02Rik, C230082I21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20744
Homologene: 7548
Abcb6
Name: ATP-binding cassette, sub-family B member 6
Synonyms: 1200005B17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74104
HGNC: HGNC:47
Homologene: 11375
Avil
Name: advillin
Synonyms: DOC6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11567
Homologene: 38200
Zglp1
Name: zinc finger, GATA-like protein 1
Synonyms: Glp1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 100009600
VEGA: 9
Homologene: 104472
Zbtb5
Name: zinc finger and BTB domain containing 5
Synonyms: 9430083K24Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230119
Homologene: 8913
Fig4
Name: FIG4 phosphoinositide 5-phosphatase
Synonyms: A530089I17Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103199
VEGA: 10
Homologene: 6713
Stxbp4
Name: syntaxin binding protein 4
Synonyms: Synip, 6030470M02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20913
Homologene: 7963
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: D86 mRNA, PKHDL1, fibrocystin L
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 192190
Homologene: 16332
Ccdc175
Name: coiled-coil domain containing 175
Synonyms: 4930403N07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 73936
VEGA: 12
Homologene: 79144
Wdr17
Name: WD repeat domain 17
Synonyms: 3010002I12Rik, B230207L18Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244484
Homologene: 12460
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Map6
Name: microtubule-associated protein 6
Synonyms: F-STOP, STOP, 2810411E12Rik, Mtap6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17760
HGNC: HGNC:6868
Homologene: 7850
Col19a1
Name: collagen, type XIX, alpha 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12823
HGNC: HGNC:2196
Homologene: 55608
Muc5b
Name: mucin 5, subtype B, tracheobronchial
Synonyms: MUC9, MUC5, 2300002I04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74180
HGNC: HGNC:7516
Homologene: 136756
Rab11fip1
Name: RAB11 family interacting protein 1 (class I)
Synonyms: 2010200K21Rik, 4833414G05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 75767
Homologene: 11853
Bmal2
Name: basic helix-loop-helix ARNT like 2
Synonyms: 4632430A05Rik, MOP9, bHLHe6, Arntl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 272322
Homologene: 10609
Cacna1b
Name: calcium channel, voltage-dependent, N type, alpha 1B subunit
Synonyms: Cchn1a, alpha(1B), Cav2.2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12287
HGNC: HGNC:1389
Homologene: 20184
Vil1
Name: villin 1
Synonyms: Villin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22349
Homologene: 5169
Usp9y
Name: ubiquitin specific peptidase 9, Y chromosome
Synonyms: Dffry, Fafl2
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 107868
Homologene: 68408
Ttll6
Name: tubulin tyrosine ligase-like family, member 6
Synonyms: t8130b59, 4932418K24Rik, D11Moh43e, D11Moh44e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237930
Homologene: 18229
4932414N04Rik
Name: RIKEN cDNA 4932414N04 gene
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75721
Homologene: 138468
C1ra
Name: complement component 1, r subcomponent A
Synonyms: mC1rA
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 50909
HGNC: HGNC:1246
Homologene: 1313
Zfp937
Name: zinc finger protein 937
Synonyms: Gm4979
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 245174
Homologene: 136215
Selplg
Name: selectin, platelet (p-selectin) ligand
Synonyms: Psgl-1, Psgl1, CD162
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20345
Homologene: 2261
Aldh3b3
Name: aldehyde dehydrogenase 3 family, member B3
Synonyms: 1700055N04Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73458
HGNC: HGNC:411
Homologene: 133295
Terf2
Name: telomeric repeat binding factor 2
Synonyms: TRF2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 21750
Homologene: 4133
Dpf3
Name: double PHD fingers 3
Synonyms: cer-d4, 2810403B03Rik, CERD4, Gm18872
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70127
Homologene: 129842
Gm6133
Name: predicted gene 6133
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 620155
VEGA: 18
Arhgap45
Name: Rho GTPase activating protein 45
Synonyms: 6330406L22Rik, Hmha1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70719
Homologene: 69120
Mtcl3
Name: MTCL family member 3
Synonyms: 6330407J23Rik, Soga3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67412
VEGA: 10
Homologene: 28227
Zfp764l1
Name: zinc finger protein 764 like 1
Synonyms: E430018J23Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101604
Homologene: 138471
Or5b121
Name: olfactory receptor family 5 subfamily B member 121
Synonyms: GA_x6K02T2RE5P-3862389-3863336, MOR202-44, Olfr1480
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 404339
Homologene: 110492
Thnsl1
Name: threonine synthase-like 1 (bacterial)
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 208967
Homologene: 32609
Rhbdd2
Name: rhomboid domain containing 2
Synonyms: 0610011L13Rik, Rhbdl7, Usmg1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 215160
Homologene: 32481
Vmn2r31
Name: vomeronasal 2, receptor 31
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100042591
Homologene: 113703
Or14j1
Name: olfactory receptor family 14 subfamily J member 1
Synonyms: MOR218-8, GA_x6K02T2PSCP-2291580-2292542, Olfr125
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258287
Homologene: 114633
Or5d39
Name: olfactory receptor family 5 subfamily D member 39
Synonyms: GA_x6K02T2Q125-49641892-49640942, MOR174-16, Olfr1167
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258291
Homologene: 138307
Clec4a1
Name: C-type lectin domain family 4, member a1
Synonyms: mDcir4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 269799
Homologene: 72399
Or4a70
Name: olfactory receptor family 4 subfamily A member 70
Synonyms: GA_x6K02T2Q125-50937307-50936387, MOR231-5, Olfr1242
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258970
Homologene: 27316
Tlnrd1
Name: talin rod domain containing 1
Synonyms: Mesdc1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80889
Homologene: 11209
Pcdhga8
Name: protocadherin gamma subfamily A, 8
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93716
HGNC: HGNC:8706
Homologene: 57162
Gm9195
Name: predicted gene 9195
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 675947
Homologene: 139067
Krtap5-24
Name: keratin associated protein 5-24
Synonyms: Gm40460
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 105244938
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 24,317,707 bp
  • A to C, chromosome 1 at 74,419,899 bp
  • A to G, chromosome 1 at 75,173,604 bp
  • A to T, chromosome 1 at 151,808,222 bp
  • G to A, chromosome 1 at 151,808,223 bp
  • A to T, chromosome 2 at 21,211,788 bp
  • G to A, chromosome 2 at 24,616,862 bp
  • A to T, chromosome 2 at 37,600,754 bp
  • A to G, chromosome 2 at 53,108,431 bp
  • T to C, chromosome 2 at 68,664,231 bp
  • A to G, chromosome 2 at 88,149,761 bp
  • C to T, chromosome 2 at 89,494,292 bp
  • C to A, chromosome 2 at 112,678,093 bp
  • C to A, chromosome 2 at 112,678,094 bp
  • T to A, chromosome 2 at 150,239,346 bp
  • A to T, chromosome 3 at 14,863,572 bp
  • G to A, chromosome 3 at 41,604,690 bp
  • T to C, chromosome 3 at 123,350,763 bp
  • A to G, chromosome 4 at 44,994,905 bp
  • T to C, chromosome 4 at 70,433,442 bp
  • A to G, chromosome 4 at 154,970,038 bp
  • GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT, chromosome 5 at 113,819,695 bp
  • T to A, chromosome 5 at 135,636,177 bp
  • G to A, chromosome 6 at 82,760,169 bp
  • G to A, chromosome 6 at 122,928,039 bp
  • G to A, chromosome 6 at 124,517,725 bp
  • G to A, chromosome 6 at 146,818,871 bp
  • A to T, chromosome 7 at 7,384,580 bp
  • A to T, chromosome 7 at 83,882,338 bp
  • CGGCGGCGG to CGGCGGCGGGGGCGGCGG, chromosome 7 at 97,579,917 bp
  • A to T, chromosome 7 at 99,269,138 bp
  • C to T, chromosome 7 at 127,393,324 bp
  • A to T, chromosome 7 at 131,079,511 bp
  • T to C, chromosome 7 at 137,445,022 bp
  • C to T, chromosome 7 at 141,861,171 bp
  • CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,817 bp
  • T to C, chromosome 8 at 27,156,581 bp
  • T to A, chromosome 8 at 41,084,615 bp
  • T to C, chromosome 8 at 54,661,336 bp
  • C to T, chromosome 8 at 90,956,438 bp
  • C to T, chromosome 8 at 107,072,721 bp
  • C to T, chromosome 9 at 21,062,607 bp
  • T to C, chromosome 9 at 44,809,071 bp
  • A to T, chromosome 9 at 86,535,932 bp
  • C to T, chromosome 9 at 106,176,666 bp
  • G to T, chromosome 10 at 29,196,523 bp
  • A to G, chromosome 10 at 41,230,005 bp
  • A to T, chromosome 10 at 80,022,300 bp
  • G to A, chromosome 10 at 80,057,499 bp
  • C to T, chromosome 10 at 127,007,591 bp
  • G to A, chromosome 11 at 90,594,813 bp
  • A to G, chromosome 11 at 96,154,846 bp
  • A to G, chromosome 12 at 13,356,959 bp
  • T to A, chromosome 12 at 70,887,055 bp
  • A to G, chromosome 12 at 72,155,624 bp
  • A to C, chromosome 12 at 83,331,927 bp
  • G to A, chromosome 14 at 72,482,676 bp
  • A to G, chromosome 15 at 4,814,875 bp
  • A to T, chromosome 15 at 9,113,817 bp
  • A to G, chromosome 15 at 44,512,911 bp
  • G to A, chromosome 15 at 68,178,866 bp
  • C to A, chromosome 17 at 8,949,430 bp
  • T to A, chromosome 17 at 37,835,398 bp
  • C to A, chromosome 17 at 57,220,136 bp
  • A to G, chromosome 18 at 37,727,937 bp
  • A to T, chromosome 18 at 78,349,793 bp
  • A to G, chromosome 19 at 3,964,549 bp
  • A to T, chromosome 19 at 13,530,453 bp
  • G to T, chromosome Y at 1,432,180 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7481 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045555-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.