Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7490Btlr/Mmmh
Stock Number:
045564-MU
Citation ID:
RRID:MMRRC_045564-MU
Other Names:
R7490 (G1)
Major Collection:

Strain Information

Dnmt3a
Name: DNA methyltransferase 3A
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13435
HGNC: HGNC:2978
Homologene: 7294
Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Ppp1r16b
Name: protein phosphatase 1, regulatory subunit 16B
Synonyms: ANKRD4, Wdt4, C130078N17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228852
Homologene: 9194
Nrg1
Name: neuregulin 1
Synonyms: HGL, HRG, Hgl, SMDF, GGF, ARIA, heregulin, D230005F13Rik, HRGalpha, 6030402G23Rik, GGFII, NDF
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 211323
HGNC: HGNC:7997
Homologene: 138451
Ppp4c
Name: protein phosphatase 4, catalytic subunit
Synonyms: PPX, 1110002D08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56420
HGNC: HGNC:9319
Homologene: 2038
Tti1
Name: TELO2 interacting protein 1
Synonyms: 2610036D13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75425
Homologene: 40969
Scg3
Name: secretogranin III
Synonyms: SgIII, Chgd, 1B1075
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20255
VEGA: 9
Homologene: 7526
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 36,164,508 bp
  • T to C, chromosome 1 at 53,163,230 bp
  • T to C, chromosome 1 at 54,648,300 bp
  • T to A, chromosome 1 at 82,287,264 bp
  • CGCTGCTGCTGCTGCTGCTGCTGCTGC to CGCTGCTGCTGCTGCTGCTGCTGC, chromosome 1 at 84,585,549 bp
  • C to T, chromosome 1 at 171,256,600 bp
  • A to T, chromosome 2 at 28,571,141 bp
  • A to T, chromosome 2 at 85,840,963 bp
  • A to C, chromosome 2 at 88,959,048 bp
  • A to G, chromosome 2 at 114,158,868 bp
  • A to T, chromosome 2 at 118,876,892 bp
  • T to A, chromosome 2 at 157,995,472 bp
  • T to C, chromosome 2 at 158,761,468 bp
  • A to T, chromosome 2 at 168,675,352 bp
  • CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT to CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT, chromosome 3 at 95,888,136 bp
  • GTCACTGGTTCTGTG to GTCACTGGTTCTGTGTTCACTGGTTCTGTG, chromosome 3 at 95,888,166 bp
  • TGGTT to TGGTTCTGTGGTCACGGGTT, chromosome 3 at 95,888,186 bp
  • T to A, chromosome 3 at 126,958,889 bp
  • A to T, chromosome 4 at 126,439,505 bp
  • A to G, chromosome 4 at 155,862,023 bp
  • T to A, chromosome 5 at 21,523,060 bp
  • A to T, chromosome 5 at 90,786,657 bp
  • T to C, chromosome 5 at 148,891,682 bp
  • T to C, chromosome 6 at 42,744,805 bp
  • T to A, chromosome 6 at 49,439,232 bp
  • A to G, chromosome 6 at 51,457,544 bp
  • T to A, chromosome 6 at 58,435,229 bp
  • T to C, chromosome 7 at 24,987,470 bp
  • G to T, chromosome 7 at 44,902,789 bp
  • T to A, chromosome 7 at 45,700,318 bp
  • G to A, chromosome 7 at 102,973,810 bp
  • C to T, chromosome 7 at 125,647,491 bp
  • A to T, chromosome 7 at 126,787,332 bp
  • C to T, chromosome 7 at 127,773,627 bp
  • T to A, chromosome 7 at 127,904,973 bp
  • G to A, chromosome 7 at 138,259,828 bp
  • G to A, chromosome 8 at 31,818,654 bp
  • T to C, chromosome 8 at 70,895,506 bp
  • A to T, chromosome 8 at 121,605,017 bp
  • A to T, chromosome 9 at 18,815,933 bp
  • T to A, chromosome 9 at 40,006,424 bp
  • T to C, chromosome 9 at 75,669,277 bp
  • T to C, chromosome 9 at 85,718,934 bp
  • T to C, chromosome 9 at 96,566,122 bp
  • C to T, chromosome 10 at 26,339,231 bp
  • A to T, chromosome 10 at 100,341,583 bp
  • T to C, chromosome 10 at 128,308,440 bp
  • T to A, chromosome 11 at 8,916,265 bp
  • C to A, chromosome 11 at 62,834,123 bp
  • T to C, chromosome 11 at 110,277,611 bp
  • C to T, chromosome 11 at 119,915,443 bp
  • G to A, chromosome 12 at 3,904,204 bp
  • T to C, chromosome 12 at 69,197,606 bp
  • G to T, chromosome 12 at 84,941,911 bp
  • C to A, chromosome 13 at 27,352,770 bp
  • T to A, chromosome 13 at 33,893,835 bp
  • T to A, chromosome 13 at 42,157,650 bp
  • C to T, chromosome 13 at 49,530,342 bp
  • T to G, chromosome 13 at 54,524,349 bp
  • T to A, chromosome 14 at 16,241,066 bp
  • G to A, chromosome 14 at 31,545,086 bp
  • A to G, chromosome 14 at 55,770,433 bp
  • GGTATTAGCGGAGT to GGT, chromosome 14 at 57,602,621 bp
  • C to T, chromosome 15 at 26,311,101 bp
  • T to A, chromosome 15 at 59,337,204 bp
  • T to C, chromosome 16 at 3,980,131 bp
  • A to C, chromosome 16 at 45,096,400 bp
  • T to C, chromosome 16 at 89,898,195 bp
  • A to T, chromosome 17 at 13,949,013 bp
  • T to C, chromosome 17 at 24,182,520 bp
  • A to G, chromosome 17 at 31,232,312 bp
  • G to T, chromosome 17 at 34,731,080 bp
  • A to G, chromosome 17 at 35,140,842 bp
  • T to A, chromosome 18 at 20,451,936 bp
  • G to A, chromosome 18 at 32,939,545 bp
  • T to C, chromosome 18 at 57,477,285 bp
  • C to A, chromosome 18 at 65,448,211 bp
  • G to A, chromosome 19 at 45,767,447 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7490 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045564-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.