Strain Name:
C57BL/6J-MtgxR7490Btlr/Mmmh
Stock Number:
045564-MU
Citation ID:
RRID:MMRRC_045564-MU
Other Names:
R7490 (G1)
Major Collection:

Strain Information

Dnmt3a
Name: DNA methyltransferase 3A
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13435
HGNC: HGNC:2978
Homologene: 7294
Ank2
Name: ankyrin 2, brain
Synonyms: Gm4392, Ank-2, ankyrin B, Ankyrin-2, Ankyrin-B
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Ppp1r16b
Name: protein phosphatase 1, regulatory subunit 16B
Synonyms: Wdt4, C130078N17Rik, ANKRD4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228852
Homologene: 9194
Nrg1
Name: neuregulin 1
Synonyms: ARIA, HRGalpha, NDF, D230005F13Rik, HGL, Hgl, HRG, GGFII, SMDF, 6030402G23Rik, heregulin, GGF
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 211323
HGNC: HGNC:7997
Homologene: 138451
Ppp4c
Name: protein phosphatase 4, catalytic subunit
Synonyms: 1110002D08Rik, PPX
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56420
HGNC: HGNC:9319
Homologene: 2038
Tti1
Name: TELO2 interacting protein 1
Synonyms: 2610036D13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75425
Homologene: 40969
Scg3
Name: secretogranin III
Synonyms: SgIII, Chgd, 1B1075
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20255
VEGA: 9
Homologene: 7526
Gtf3c1
Name: general transcription factor III C 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233863
HGNC: HGNC:4664
Homologene: 31040
Pan2
Name: PAN2 poly(A) specific ribonuclease subunit
Synonyms: Usp52, 1200014O24Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103135
VEGA: 10
Homologene: 5918
Ago1
Name: argonaute RISC catalytic subunit 1
Synonyms: argonaute 1, Eif2c1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 236511
HGNC: HGNC:3262
Homologene: 81826
Xpo4
Name: exportin 4
Synonyms: B430309A01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 57258
Homologene: 10733
Tiam1
Name: T cell lymphoma invasion and metastasis 1
Synonyms: D16Ium10, D16Ium10e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 21844
Homologene: 2443
Rasa2
Name: RAS p21 protein activator 2
Synonyms: 5430433H21Rik, GAP1m
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 114713
HGNC: HGNC:9872
Homologene: 4745
Aqr
Name: aquarius
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11834
Homologene: 7629
L3mbtl3
Name: L3MBTL3 histone methyl-lysine binding protein
Synonyms: MBT-1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237339
Homologene: 18226
Ccdc80
Name: coiled-coil domain containing 80
Synonyms: Ssg1, DRO1, Urb, 2610001E17Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67896
Homologene: 12206
Arel1
Name: apoptosis resistant E3 ubiquitin protein ligase 1
Synonyms: 1110018G07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68497
Homologene: 8885
Malt1
Name: MALT1 paracaspase
Synonyms: paracaspase, Pcasp1, D430033E09Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240354
HGNC: HGNC:6819
Homologene: 4938
Oga
Name: O-GlcNAcase
Synonyms: Mgea5, Hy5, 4833427O07Rik, 5830447M11Rik, 2810009A20Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 76055
VEGA: 19
HGNC: HGNC:7056
Homologene: 8154
Adcy4
Name: adenylate cyclase 4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 104110
VEGA: 14
HGNC: HGNC:235
Homologene: 23149
Dsg4
Name: desmoglein 4
Synonyms: lah, CDHF13
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16769
Homologene: 65341
Ap2a1
Name: adaptor-related protein complex 2, alpha 1 subunit
Synonyms: Adtaa
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11771
HGNC: HGNC:561
Homologene: 68997
Ibtk
Name: inhibitor of Bruton agammaglobulinemia tyrosine kinase
Synonyms: 5430411K16Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 108837
Homologene: 34661
Uggt1
Name: UDP-glucose glycoprotein glucosyltransferase 1
Synonyms: Ugcgl1, A930007H10Rik, C820010P03Rik, 0910001L17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320011
Homologene: 10586
Marchf11
Name: membrane associated ring-CH-type finger 11
Synonyms: March11
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 211147
Homologene: 45584
Pkd1l1
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171395
Homologene: 51376
Washc5
Name: WASH complex subunit 5
Synonyms: strumpellin, E430025E21Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223593
VEGA: 15
Homologene: 8898
Tas1r3
Name: taste receptor, type 1, member 3
Synonyms: T1r3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 83771
Homologene: 12890
Adamts4
Name: ADAM metallopeptidase with thrombospondin type 1 motif 4
Synonyms: aggrecanase-1, ADAM-TS4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240913
HGNC: HGNC:220
Homologene: 36169
Zcchc14
Name: zinc finger, CCHC domain containing 14
Synonyms: Bdg29
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 142682
Homologene: 9037
Katnal1
Name: katanin p60 subunit A-like 1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231912
Homologene: 12942
Atp1a3
Name: ATPase, Na+/K+ transporting, alpha 3 polypeptide
Synonyms: Atpa-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232975
HGNC: HGNC:801
Homologene: 113729
Trim16
Name: tripartite motif-containing 16
Synonyms: 9130006M08Rik, EBBP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 94092
Homologene: 4726
Dner
Name: delta/notch-like EGF repeat containing
Synonyms: A930026D19Rik, BET
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227325
Homologene: 26722
Or10g9b
Name: olfactory receptor family 10 subfamily G member 9B
Synonyms: Olfr980, GA_x6K02T2PVTD-33705428-33704496, MOR223-2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 259110
VEGA: 9
Homologene: 81557
Stk31
Name: serine threonine kinase 31
Synonyms: C330007K24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 77485
Homologene: 12677
Irs1
Name: insulin receptor substrate 1
Synonyms: IRS-1, G972R
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16367
HGNC: HGNC:6125
Homologene: 4049
Slx4
Name: SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)
Synonyms: D16Bwg1016e, Btbd12
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 52864
Homologene: 23770
Chmp6
Name: charged multivesicular body protein 6
Synonyms: chromatin modifying protein 6, 2400004G01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 208092
Homologene: 11607
Fbxl13
Name: F-box and leucine-rich repeat protein 13
Synonyms: 4921539K22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320118
Homologene: 27057
Ecm2
Name: extracellular matrix protein 2, female organ and adipocyte specific
Synonyms: tenonectin, 9030618O22Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 407800
VEGA: 13
HGNC: HGNC:3154
Homologene: 1064
Gtf3c5
Name: general transcription factor IIIC, polypeptide 5
Synonyms: 2700084A09Rik, TFiiiC2-63, TFIIIC63, TFIIICepsilon
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70239
HGNC: HGNC:4668
Homologene: 40806
Gm7168
Name: predicted gene 7168
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 635895
Homologene: 133217
C4b
Name: complement C4B (Chido blood group)
Synonyms: Ss, C4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12268
Homologene: 36030
Hivep1
Name: human immunodeficiency virus type I enhancer binding protein 1
Synonyms: alphaA-CRYBP1, Cryabp1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110521
VEGA: 13
HGNC: HGNC:4920
Homologene: 1596
Abca5
Name: ATP-binding cassette, sub-family A member 5
Synonyms: B930033A02Rik, ABC13
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217265
HGNC: HGNC:35
Homologene: 10263
Atp9a
Name: ATPase, class II, type 9A
Synonyms: IIa, Class II
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11981
Homologene: 69194
BC028528
Name: cDNA sequence BC028528
Synonyms: L259
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229600
Homologene: 49773
Simc1
Name: SUMO-interacting motifs containing 1
Synonyms: 4732471D19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 319719
Homologene: 131217
Bag6
Name: BCL2-associated athanogene 6
Synonyms: D17H6S52E, 2410045D21Rik, G3, Scythe, Bat3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224727
Homologene: 3409
Serpinb6c
Name: serine (or cysteine) peptidase inhibitor, clade B, member 6c
Synonyms: Spi3C, SPIC, ovalbumin
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 97848
HGNC: HGNC:8950
Camk4
Name: calcium/calmodulin-dependent protein kinase IV
Synonyms: D18Bwg0362e, Ca2+/calmodulin-dependent protein kinase type IV/Gr, A430110E23Rik, CaMKIV, CaMKIV/Gr
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12326
VEGA: 18
HGNC: HGNC:1464
Homologene: 100780
Or4c107
Name: olfactory receptor family 4 subfamily C member 107
Synonyms: MOR233-17, GA_x6K02T2Q125-50437014-50437949, Olfr1212, MOR233-20
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258241
Homologene: 66154
Nfe2l3
Name: nuclear factor, erythroid derived 2, like 3
Synonyms: Nrf3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18025
HGNC: HGNC:7783
Homologene: 3168
Colq
Name: collagen like tail subunit of asymmetric acetylcholinesterase
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 382864
HGNC: HGNC:2226
Dnaaf2
Name: dynein, axonemal assembly factor 2
Synonyms: 2810020C19Rik, kintoun, Ktu, 1110034A24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 109065
Homologene: 10026
Or7g16
Name: olfactory receptor family 7 subfamily G member 16
Synonyms: MOR149-1, GA_x6K02T2PVTD-12559294-12558356, Olfr828
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258598
HGNC: HGNC:8466
Homologene: 133690
Vmn1r30
Name: vomeronasal 1 receptor 30
Synonyms: V1rc9, V1rc22
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171195
Homologene: 137652
Tcerg1l
Name: transcription elongation regulator 1-like
Synonyms: 5730476P14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70571
Homologene: 52165
Ankrd44
Name: ankyrin repeat domain 44
Synonyms: E130014H08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329154
Homologene: 27547
Or5ar1
Name: olfactory receptor family 5 subfamily AR member 1
Synonyms: GA_x6K02T2Q125-47320309-47319377, Olfr1019, MOR180-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259017
Homologene: 17464
Prl8a2
Name: prolactin family 8, subfamily a, member 2
Synonyms: DPRP, Dtprp, mdPRP, D/tPRP
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13529
Homologene: 49230
Oxsm
Name: 3-oxoacyl-ACP synthase, mitochondrial
Synonyms: 4933425A18Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71147
Homologene: 5820
Ubash3a
Name: ubiquitin associated and SH3 domain containing, A
Synonyms: TULA, Sts-2, 5830413C03Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328795
Homologene: 56833
Rpl18a
Name: ribosomal protein L18A
Synonyms: 2510019J09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76808
Homologene: 68104
Or2f1
Name: olfactory receptor family 2 subfamily F member 1
Synonyms: MOR257-8P, Olfr453, GA_x6K02T2P3E9-4815856-4814903
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258016
HGNC: HGNC:8246
Homologene: 128151
Car11
Name: carbonic anhydrase 11
Synonyms: CA-RP XI
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12348
HGNC: HGNC:1370
Homologene: 36061
Ivd
Name: isovaleryl coenzyme A dehydrogenase
Synonyms: 1300016K07Rik, 6720455E18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56357
HGNC: HGNC:6186
Homologene: 1676
Tbc1d24
Name: TBC1 domain family, member 24
Synonyms: C530046L02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224617
Homologene: 27469
Orai3
Name: ORAI calcium release-activated calcium modulator 3
Synonyms: Tmem142c
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269999
Homologene: 72082
1700019A02Rik
Name: RIKEN cDNA 1700019A02 gene
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69397
Or51g2
Name: olfactory receptor family 51 subfamily G member 2
Synonyms: Olfr577, GA_x6K02T2PBJ9-5685322-5684384, MOR7-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259113
Homologene: 64962
Bckdk
Name: branched chain ketoacid dehydrogenase kinase
Synonyms: BCKD-kinase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12041
Homologene: 37642
Cxcl3
Name: C-X-C motif chemokine ligand 3
Synonyms: Dcip1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330122
Homologene: 138183
Alyreffm5
Name: Aly/REF export factor family member 5
Synonyms: Gm4302
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100043227
VEGA: 10
Homologene: 130068
Ctxn3
Name: cortexin 3
Synonyms: ENSMUSG00000069372
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 629147
Homologene: 85473
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 36,164,508 bp
  • T to C, chromosome 1 at 53,163,230 bp
  • T to C, chromosome 1 at 54,648,300 bp
  • T to A, chromosome 1 at 82,287,264 bp
  • CGCTGCTGCTGCTGCTGCTGCTGCTGC to CGCTGCTGCTGCTGCTGCTGCTGC, chromosome 1 at 84,585,549 bp
  • C to T, chromosome 1 at 171,256,600 bp
  • A to T, chromosome 2 at 28,571,141 bp
  • A to T, chromosome 2 at 85,840,963 bp
  • A to C, chromosome 2 at 88,959,048 bp
  • A to G, chromosome 2 at 114,158,868 bp
  • A to T, chromosome 2 at 118,876,892 bp
  • T to A, chromosome 2 at 157,995,472 bp
  • T to C, chromosome 2 at 158,761,468 bp
  • A to T, chromosome 2 at 168,675,352 bp
  • CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT to CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT, chromosome 3 at 95,888,136 bp
  • GTCACTGGTTCTGTG to GTCACTGGTTCTGTGTTCACTGGTTCTGTG, chromosome 3 at 95,888,166 bp
  • TGGTT to TGGTTCTGTGGTCACGGGTT, chromosome 3 at 95,888,186 bp
  • T to A, chromosome 3 at 126,958,889 bp
  • A to T, chromosome 4 at 126,439,505 bp
  • A to G, chromosome 4 at 155,862,023 bp
  • T to A, chromosome 5 at 21,523,060 bp
  • A to T, chromosome 5 at 90,786,657 bp
  • T to C, chromosome 5 at 148,891,682 bp
  • T to C, chromosome 6 at 42,744,805 bp
  • T to A, chromosome 6 at 49,439,232 bp
  • A to G, chromosome 6 at 51,457,544 bp
  • T to A, chromosome 6 at 58,435,229 bp
  • T to C, chromosome 7 at 24,987,470 bp
  • G to T, chromosome 7 at 44,902,789 bp
  • T to A, chromosome 7 at 45,700,318 bp
  • G to A, chromosome 7 at 102,973,810 bp
  • C to T, chromosome 7 at 125,647,491 bp
  • A to T, chromosome 7 at 126,787,332 bp
  • C to T, chromosome 7 at 127,773,627 bp
  • T to A, chromosome 7 at 127,904,973 bp
  • G to A, chromosome 7 at 138,259,828 bp
  • G to A, chromosome 8 at 31,818,654 bp
  • T to C, chromosome 8 at 70,895,506 bp
  • A to T, chromosome 8 at 121,605,017 bp
  • A to T, chromosome 9 at 18,815,933 bp
  • T to A, chromosome 9 at 40,006,424 bp
  • T to C, chromosome 9 at 75,669,277 bp
  • T to C, chromosome 9 at 85,718,934 bp
  • T to C, chromosome 9 at 96,566,122 bp
  • C to T, chromosome 10 at 26,339,231 bp
  • A to T, chromosome 10 at 100,341,583 bp
  • T to C, chromosome 10 at 128,308,440 bp
  • T to A, chromosome 11 at 8,916,265 bp
  • C to A, chromosome 11 at 62,834,123 bp
  • T to C, chromosome 11 at 110,277,611 bp
  • C to T, chromosome 11 at 119,915,443 bp
  • G to A, chromosome 12 at 3,904,204 bp
  • T to C, chromosome 12 at 69,197,606 bp
  • G to T, chromosome 12 at 84,941,911 bp
  • C to A, chromosome 13 at 27,352,770 bp
  • T to A, chromosome 13 at 33,893,835 bp
  • T to A, chromosome 13 at 42,157,650 bp
  • C to T, chromosome 13 at 49,530,342 bp
  • T to G, chromosome 13 at 54,524,349 bp
  • T to A, chromosome 14 at 16,241,066 bp
  • G to A, chromosome 14 at 31,545,086 bp
  • A to G, chromosome 14 at 55,770,433 bp
  • GGTATTAGCGGAGT to GGT, chromosome 14 at 57,602,621 bp
  • C to T, chromosome 15 at 26,311,101 bp
  • T to A, chromosome 15 at 59,337,204 bp
  • T to C, chromosome 16 at 3,980,131 bp
  • A to C, chromosome 16 at 45,096,400 bp
  • T to C, chromosome 16 at 89,898,195 bp
  • A to T, chromosome 17 at 13,949,013 bp
  • T to C, chromosome 17 at 24,182,520 bp
  • A to G, chromosome 17 at 31,232,312 bp
  • G to T, chromosome 17 at 34,731,080 bp
  • A to G, chromosome 17 at 35,140,842 bp
  • T to A, chromosome 18 at 20,451,936 bp
  • G to A, chromosome 18 at 32,939,545 bp
  • T to C, chromosome 18 at 57,477,285 bp
  • C to A, chromosome 18 at 65,448,211 bp
  • G to A, chromosome 19 at 45,767,447 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7490 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045564-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.