Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7491Btlr/Mmmh
Stock Number:
045565-MU
Citation ID:
RRID:MMRRC_045565-MU
Other Names:
R7491 (G1)
Major Collection:

Strain Information

Col2a1
Name: collagen, type II, alpha 1
Synonyms: Del1, Col2a-1, Col2a, Col2, M100856, Rgsc856, Lpk, M100413, Rgsc413
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12824
HGNC: HGNC:2200
Homologene: 55607
Kmt2c
Name: lysine (K)-specific methyltransferase 2C
Synonyms: E330008K23Rik, HALR, Mll3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231051
Homologene: 46480
Limch1
Name: LIM and calponin homology domains 1
Synonyms: 3732412D22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77569
Homologene: 18953
D630045J12Rik
Name: RIKEN cDNA D630045J12 gene
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330286
Homologene: 19782
Nae1
Name: NEDD8 activating enzyme E1 subunit 1
Synonyms: Appbp1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234664
HGNC: HGNC:621
Homologene: 68370
Adcy9
Name: adenylate cyclase 9
Synonyms: D16Wsu65e, ACtp10
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11515
HGNC: HGNC:240
Homologene: 868
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 52,152,371 bp
  • A to T, chromosome 1 at 90,939,378 bp
  • A to T, chromosome 1 at 97,127,854 bp
  • T to C, chromosome 1 at 144,245,396 bp
  • T to C, chromosome 2 at 60,620,376 bp
  • T to C, chromosome 2 at 65,702,008 bp
  • G to T, chromosome 2 at 68,614,755 bp
  • T to C, chromosome 2 at 130,393,567 bp
  • A to T, chromosome 2 at 160,312,022 bp
  • CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT to CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT, chromosome 3 at 95,888,136 bp
  • CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT to CACTGGTTCTGTGGTTACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT, chromosome 3 at 95,888,138 bp
  • T to A, chromosome 3 at 103,326,148 bp
  • A to G, chromosome 3 at 144,813,579 bp
  • T to A, chromosome 4 at 43,426,528 bp
  • T to A, chromosome 4 at 49,521,569 bp
  • T to A, chromosome 4 at 62,417,876 bp
  • T to C, chromosome 4 at 76,133,155 bp
  • A to C, chromosome 4 at 86,445,407 bp
  • A to G, chromosome 4 at 107,907,142 bp
  • A to T, chromosome 4 at 120,098,830 bp
  • T to A, chromosome 4 at 130,719,174 bp
  • T to G, chromosome 5 at 3,701,911 bp
  • T to A, chromosome 5 at 25,284,564 bp
  • T to G, chromosome 5 at 44,188,636 bp
  • A to G, chromosome 5 at 48,219,994 bp
  • T to G, chromosome 5 at 67,054,237 bp
  • C to A, chromosome 5 at 137,322,820 bp
  • A to G, chromosome 5 at 150,466,326 bp
  • G to C, chromosome 6 at 29,736,120 bp
  • G to T, chromosome 6 at 37,379,859 bp
  • A to T, chromosome 6 at 38,142,666 bp
  • C to T, chromosome 6 at 72,616,420 bp
  • A to G, chromosome 6 at 88,013,642 bp
  • A to G, chromosome 6 at 106,778,904 bp
  • A to T, chromosome 6 at 115,254,654 bp
  • T to C, chromosome 6 at 118,613,343 bp
  • A to G, chromosome 7 at 8,481,343 bp
  • A to T, chromosome 7 at 11,517,885 bp
  • G to A, chromosome 7 at 12,906,906 bp
  • A to T, chromosome 7 at 80,309,491 bp
  • T to C, chromosome 7 at 102,454,557 bp
  • C to A, chromosome 7 at 110,039,194 bp
  • T to C, chromosome 7 at 113,299,424 bp
  • C to A, chromosome 7 at 122,170,533 bp
  • ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,713 bp
  • A to G, chromosome 8 at 57,552,518 bp
  • C to G, chromosome 8 at 72,746,441 bp
  • C to A, chromosome 8 at 84,559,293 bp
  • A to T, chromosome 8 at 104,518,239 bp
  • T to G, chromosome 9 at 39,623,972 bp
  • T to C, chromosome 9 at 63,146,448 bp
  • G to T, chromosome 9 at 80,123,728 bp
  • T to A, chromosome 9 at 118,769,111 bp
  • A to G, chromosome 10 at 34,152,565 bp
  • T to C, chromosome 10 at 62,295,745 bp
  • T to A, chromosome 10 at 80,900,544 bp
  • A to G, chromosome 10 at 89,413,901 bp
  • A to T, chromosome 11 at 25,769,014 bp
  • T to A, chromosome 11 at 43,835,967 bp
  • T to A, chromosome 11 at 101,328,377 bp
  • T to C, chromosome 11 at 115,410,266 bp
  • T to C, chromosome 11 at 116,769,184 bp
  • C to A, chromosome 11 at 120,619,011 bp
  • T to C, chromosome 12 at 8,986,000 bp
  • A to T, chromosome 12 at 10,374,903 bp
  • T to C, chromosome 12 at 101,885,435 bp
  • T to A, chromosome 13 at 19,242,846 bp
  • C to T, chromosome 13 at 54,588,604 bp
  • T to C, chromosome 13 at 97,944,686 bp
  • A to C, chromosome 13 at 100,217,071 bp
  • A to T, chromosome 13 at 104,069,323 bp
  • A to T, chromosome 13 at 113,172,001 bp
  • C to T, chromosome 14 at 21,234,929 bp
  • A to G, chromosome 14 at 34,399,417 bp
  • A to T, chromosome 14 at 37,068,910 bp
  • G to A, chromosome 14 at 61,005,205 bp
  • A to T, chromosome 14 at 79,082,814 bp
  • G to C, chromosome 15 at 19,013,359 bp
  • G to A, chromosome 15 at 58,600,432 bp
  • T to C, chromosome 15 at 86,032,518 bp
  • C to T, chromosome 15 at 97,976,159 bp
  • A to G, chromosome 16 at 4,418,809 bp
  • T to C, chromosome 16 at 44,470,748 bp
  • T to A, chromosome 17 at 20,228,565 bp
  • T to G, chromosome 17 at 48,257,941 bp
  • T to A, chromosome 17 at 57,052,822 bp
  • C to A, chromosome 17 at 57,072,379 bp
  • T to C, chromosome 18 at 36,954,636 bp
  • T to C, chromosome 18 at 37,727,430 bp
  • C to T, chromosome 18 at 80,972,705 bp
  • T to C, chromosome 18 at 84,015,641 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7491 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045565-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.