Strain Name:
C57BL/6J-MtgxR7491Btlr/Mmmh
Stock Number:
045565-MU
Citation ID:
RRID:MMRRC_045565-MU
Other Names:
R7491 (G1)
Major Collection:

Strain Information

Col2a1
Name: collagen, type II, alpha 1
Synonyms: Del1, Col2a-1, Col2a, Col2, M100856, Rgsc856, Lpk, M100413, Rgsc413
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12824
HGNC: HGNC:2200
Homologene: 55607
Kmt2c
Name: lysine (K)-specific methyltransferase 2C
Synonyms: E330008K23Rik, HALR, Mll3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231051
Homologene: 46480
Limch1
Name: LIM and calponin homology domains 1
Synonyms: 3732412D22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77569
Homologene: 18953
D630045J12Rik
Name: RIKEN cDNA D630045J12 gene
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330286
Homologene: 19782
Nae1
Name: NEDD8 activating enzyme E1 subunit 1
Synonyms: Appbp1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234664
HGNC: HGNC:621
Homologene: 68370
Adcy9
Name: adenylate cyclase 9
Synonyms: D16Wsu65e, ACtp10
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11515
HGNC: HGNC:240
Homologene: 868
Pum1
Name: pumilio RNA-binding family member 1
Synonyms: Pumm
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 80912
Homologene: 22830
Adk
Name: adenosine kinase
Synonyms: AK, 5033405D03Rik, 2310026J05Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 11534
VEGA: 14
HGNC: HGNC:257
Homologene: 4891
Mrpl58
Name: mitochondrial ribosomal protein L58
Synonyms: 1110002E03Rik, 1110001A02Rik, Ict1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68572
HGNC: HGNC:5359
Homologene: 1185
Trnt1
Name: tRNA nucleotidyl transferase, CCA-adding, 1
Synonyms: 2610044E04Rik, CGI-47, 2410043H24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70047
Homologene: 9333
Senp6
Name: SUMO/sentrin specific peptidase 6
Synonyms: E130319N12Rik, 2810017C20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 215351
Homologene: 9196
Sin3b
Name: transcriptional regulator, SIN3B (yeast)
Synonyms: 2810430C10Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20467
Homologene: 81810
Nln
Name: neurolysin (metallopeptidase M3 family)
Synonyms: 4930472G13Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75805
VEGA: 13
Homologene: 69315
Ankib1
Name: ankyrin repeat and IBR domain containing 1
Synonyms: 2310061P20Rik, 4631416I11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70797
Homologene: 19076
Rrm1
Name: ribonucleotide reductase M1
Synonyms: RnrM1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20133
Homologene: 806
Fry
Name: FRY microtubule binding protein
Synonyms: cg003, 9330186A19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320365
Homologene: 113770
Trip11
Name: thyroid hormone receptor interactor 11
Synonyms: 3110031G15Rik, 2610511G22Rik, 6030460N08Rik, TRIP230, GMAP-210
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 109181
Homologene: 20897
Stat1
Name: signal transducer and activator of transcription 1
Synonyms: 2010005J02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20846
Homologene: 21428
Prc1
Name: protein regulator of cytokinesis 1
Synonyms: D7Ertd348e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233406
HGNC: HGNC:9341
Homologene: 37868
Ipo7
Name: importin 7
Synonyms: RanBP7, Imp7, A330055O14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233726
HGNC: HGNC:9852
Homologene: 4659
Gas2l3
Name: growth arrest-specific 2 like 3
Synonyms: LOC237436, 8430435B07Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237436
VEGA: 10
Homologene: 18386
Bmal1
Name: basic helix-loop-helix ARNT like 1
Synonyms: Arnt3, MOP3, bHLHe5, Arntl
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11865
HGNC: HGNC:701
Homologene: 910
Slit2
Name: slit guidance ligand 2
Synonyms: Slil3, Drad-1, E130320P19Rik, E030015M03Rik, b2b1200.1Clo
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20563
Homologene: 3516
Rab7
Name: RAB7, member RAS oncogene family
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19349
HGNC: HGNC:9788
Homologene: 3408
Hk1
Name: hexokinase 1
Synonyms: Hk-1, mHk1-s, Hk1-s
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15275
HGNC: HGNC:4922
Homologene: 100530
Nop16
Name: NOP16 nucleolar protein
Synonyms: D13Wsu177e
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 28126
Homologene: 16887
Prpf4
Name: pre-mRNA processing factor 4
Synonyms: 1600015H11Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70052
Homologene: 3446
Slc12a9
Name: solute carrier family 12 (potassium/chloride transporters), member 9
Synonyms: CIP1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 83704
Homologene: 5429
Trim33
Name: tripartite motif-containing 33
Synonyms: Tif1g, 8030451N04Rik, ectodermin, Ecto
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 94093
Homologene: 9296
Zscan22
Name: zinc finger and SCAN domain containing 22
Synonyms: D530006B18Rik, Hkr2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232878
HGNC: HGNC:4929
Homologene: 68122
Dse
Name: dermatan sulfate epimerase
Synonyms: B130024B19Rik, Sart2, DS-epi1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 212898
VEGA: 10
Homologene: 8354
Tapt1
Name: transmembrane anterior posterior transformation 1
Synonyms: 4932414K18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231225
Homologene: 80206
Tnfrsf19
Name: tumor necrosis factor receptor superfamily, member 19
Synonyms: TAJ, Troy, TAJ-ALPHA, TRADE
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 29820
VEGA: 14
Homologene: 8481
Skor1
Name: SKI family transcriptional corepressor 1
Synonyms: C230094B15Rik, Corl1, Lbxcor1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 207667
Homologene: 18175
Cacna1a
Name: calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Synonyms: Cacnl1a4, alpha1A, Ccha1a, SCA6, nmf352, smrl
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12286
HGNC: HGNC:1388
Homologene: 56383
Dennd1c
Name: DENN domain containing 1C
Synonyms: 4432409M07Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 70785
VEGA: 17
Homologene: 11773
Ern2
Name: endoplasmic reticulum to nucleus signalling 2
Synonyms: Ire1b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26918
Homologene: 22687
Arhgef28
Name: Rho guanine nucleotide exchange factor 28
Synonyms: RIP2, RhoGEF, Rho specific exchange factor, D13Bwg1089e, 9230110L08Rik, p190RhoGEF, Rgnef
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110596
VEGA: 13
Homologene: 8078
Syn2
Name: synapsin II
Synonyms: 2900074L19Rik, Synapsin IIb, Synapsin IIa
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20965
Homologene: 49348
Cacna1c
Name: calcium channel, voltage-dependent, L type, alpha 1C subunit
Synonyms: (alpha)1 subunit, Cchl1a1, Cav1.2, L-type Cav1.2, D930026N18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12288
HGNC: HGNC:1390
Homologene: 55484
Sall3
Name: spalt like transcription factor 3
Synonyms: Msal, Msal-1, Spalt, Salt, B130022O04Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 20689
VEGA: 18
Homologene: 18142
Mlph
Name: melanophilin
Synonyms: Slac-2a, D1Wsu84e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 171531
Homologene: 11465
Rusc2
Name: RUN and SH3 domain containing 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100213
Homologene: 18967
Celsr1
Name: cadherin, EGF LAG seven-pass G-type receptor 1
Synonyms: Scy, Crsh, crash, Adgrc1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12614
VEGA: 15
HGNC: HGNC:1850
Homologene: 7665
Ptprd
Name: protein tyrosine phosphatase receptor type D
Synonyms: 3000002J10Rik, B230219D21Rik, 1110002J03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19266
HGNC: HGNC:9668
Mmrn2
Name: multimerin 2
Synonyms: EndoGlyx-1, ENDOGLYX1, Emilin3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105450
VEGA: 14
Homologene: 11697
Naip5
Name: NLR family, apoptosis inhibitory protein 5
Synonyms: Naip-rs3, Birc1e, Lgn1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17951
HGNC: HGNC:7634
Homologene: 113589
Itga9
Name: integrin alpha 9
Synonyms: 2610002H11Rik, D9Ertd428e, 6720458D17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 104099
HGNC: HGNC:6145
Homologene: 1664
Fer1l6
Name: fer-1 like family member 6
Synonyms: EG631797
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 631797
Homologene: 53396
Scn2a
Name: sodium channel, voltage-gated, type II, alpha
Synonyms: Nav1.2, A230052E19Rik, Scn2a1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110876
Homologene: 75001
Cfap44
Name: cilia and flagella associated protein 44
Synonyms: 6330444M21Rik, D16Ertd642e, Wdr52
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 212517
Homologene: 75085
Clca3a2
Name: chloride channel accessory 3A2
Synonyms: Clca2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80797
HGNC: HGNC:2017
Homologene: 77224
Cpt2
Name: carnitine palmitoyltransferase 2
Synonyms: CPTII, CPT II
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12896
HGNC: HGNC:2330
Homologene: 77
Vwa8
Name: von Willebrand factor A domain containing 8
Synonyms: 4932416F07Rik, 1300010F03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219189
VEGA: 14
Homologene: 44881
Tshz1
Name: teashirt zinc finger family member 1
Synonyms: NY-CO-33, D18Bwg1409e, 5730407I04Rik, Mtsh1, Sdccag33, teashirt1, Tsh1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 110796
Homologene: 4227
Aoc2
Name: amine oxidase copper containing 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237940
HGNC: HGNC:549
Homologene: 56457
Slco6c1
Name: solute carrier organic anion transporter family, member 6c1
Synonyms: 4933404A18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74441
Homologene: 65259
Vmn2r105
Name: vomeronasal 2, receptor 105
Synonyms: EG627743
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627743
Homologene: 129680
Rgs1
Name: regulator of G-protein signaling 1
Synonyms: BL34
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 50778
HGNC: HGNC:9991
Homologene: 2191
Lrit2
Name: leucine-rich repeat, immunoglobulin-like and transmembrane domains 2
Synonyms: A930010E21Rik, Lrrc22
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239038
VEGA: 14
Homologene: 18292
St6galnac1
Name: ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1
Synonyms: ST6GalNAc I, Siat7a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20445
Homologene: 7937
BC028528
Name: cDNA sequence BC028528
Synonyms: L259
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229600
Homologene: 49773
4933409G03Rik
Name: RIKEN cDNA 4933409G03 gene
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227998
Cpxm1
Name: carboxypeptidase X, M14 family member 1
Synonyms: Cpx-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56264
Homologene: 10485
Hivep3
Name: human immunodeficiency virus type I enhancer binding protein 3
Synonyms: Krc, E030045D18Rik, 2900056N03Rik, Shn3, Schnurri-3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16656
Homologene: 7803
Wdr35
Name: WD repeat domain 35
Synonyms: 4930459M12Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74682
Homologene: 10814
Itgb6
Name: integrin beta 6
Synonyms: 4831415H04Rik, 2210409C20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16420
HGNC: HGNC:6161
Homologene: 685
5730522E02Rik
Name: RIKEN cDNA 5730522E02 gene
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70626
Vmn2r45
Name: vomeronasal 2, receptor 45
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100042810
Homologene: 113703
Galnt7
Name: polypeptide N-acetylgalactosaminyltransferase 7
Synonyms: ppGaNTase-T7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 108150
HGNC: HGNC:4129
Homologene: 9685
Cdh10
Name: cadherin 10
Synonyms: T2-cadherin, A830016G23Rik, C030003B10Rik, C030011H18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320873
HGNC: HGNC:1749
Homologene: 68530
Saxo1
Name: stabilizer of axonemal microtubules 1
Synonyms: 4930500O09Rik, Fam154a
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75811
Homologene: 27548
Smo
Name: smoothened, frizzled class receptor
Synonyms: E130215L21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 319757
Homologene: 4115
Creb3l2
Name: cAMP responsive element binding protein 3-like 2
Synonyms: BBF2H7, C530025K05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 208647
Homologene: 18690
Sirt7
Name: sirtuin 7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 209011
Homologene: 56152
Tgoln1
Name: trans-golgi network protein
Synonyms: TGN38A, TGN38, Ttgn1, D6Ertd384e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22134
Homologene: 137224
Nt5c1b
Name: 5'-nucleotidase, cytosolic IB
Synonyms: 4921514H13Rik, CN-IB
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70881
Homologene: 12370
Slc25a23
Name: solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23
Synonyms: 2310067G05Rik, SCaMC-3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66972
Homologene: 11467
Gzmk
Name: granzyme K
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14945
HGNC: HGNC:4711
Homologene: 20485
Zfp189
Name: zinc finger protein 189
Synonyms: C430015I23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230162
Homologene: 20737
Adra1b
Name: adrenergic receptor, alpha 1b
Synonyms: alpha1B-adrenergic receptor
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11548
HGNC: HGNC:278
Homologene: 55477
Gm826
Name: predicted gene 826
Synonyms: LOC329554, Gm46773
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329554
Or10d4b
Name: olfactory receptor family 10 subfamily D member 4B
Synonyms: GA_x6K02T2PVTD-33320043-33320987, MOR224-12, Olfr960
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258276
VEGA: 9
Homologene: 17168
Trem3
Name: triggering receptor expressed on myeloid cells 3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 58218
VEGA: 17
Homologene: 87012
Pcdha4
Name: protocadherin alpha 4
Synonyms: Cnr1, Crnr1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12936
HGNC: HGNC:8670
Homologene: 130626
Pcdhga8
Name: protocadherin gamma subfamily A, 8
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93716
HGNC: HGNC:8706
Homologene: 57162
Timm13
Name: translocase of inner mitochondrial membrane 13
Synonyms: Tim9, D10Ertd378e, Timm9
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 30055
VEGA: 10
Homologene: 40846
Trgv3
Name: T cell receptor gamma, variable 3
Synonyms: vgamma3, Tcrg-V3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21637
Krtap5-24
Name: keratin associated protein 5-24
Synonyms: Gm40460
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 105244938
Zscan4-ps2
Name: zinc finger and SCAN domain containing 4, pseudogene 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 665913
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 52,152,371 bp
  • A to T, chromosome 1 at 90,939,378 bp
  • A to T, chromosome 1 at 97,127,854 bp
  • T to C, chromosome 1 at 144,245,396 bp
  • T to C, chromosome 2 at 60,620,376 bp
  • T to C, chromosome 2 at 65,702,008 bp
  • G to T, chromosome 2 at 68,614,755 bp
  • T to C, chromosome 2 at 130,393,567 bp
  • A to T, chromosome 2 at 160,312,022 bp
  • CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT to CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT, chromosome 3 at 95,888,136 bp
  • CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT to CACTGGTTCTGTGGTTACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT, chromosome 3 at 95,888,138 bp
  • T to A, chromosome 3 at 103,326,148 bp
  • A to G, chromosome 3 at 144,813,579 bp
  • T to A, chromosome 4 at 43,426,528 bp
  • T to A, chromosome 4 at 49,521,569 bp
  • T to A, chromosome 4 at 62,417,876 bp
  • T to C, chromosome 4 at 76,133,155 bp
  • A to C, chromosome 4 at 86,445,407 bp
  • A to G, chromosome 4 at 107,907,142 bp
  • A to T, chromosome 4 at 120,098,830 bp
  • T to A, chromosome 4 at 130,719,174 bp
  • T to G, chromosome 5 at 3,701,911 bp
  • T to A, chromosome 5 at 25,284,564 bp
  • T to G, chromosome 5 at 44,188,636 bp
  • A to G, chromosome 5 at 48,219,994 bp
  • T to G, chromosome 5 at 67,054,237 bp
  • C to A, chromosome 5 at 137,322,820 bp
  • A to G, chromosome 5 at 150,466,326 bp
  • G to C, chromosome 6 at 29,736,120 bp
  • G to T, chromosome 6 at 37,379,859 bp
  • A to T, chromosome 6 at 38,142,666 bp
  • C to T, chromosome 6 at 72,616,420 bp
  • A to G, chromosome 6 at 88,013,642 bp
  • A to G, chromosome 6 at 106,778,904 bp
  • A to T, chromosome 6 at 115,254,654 bp
  • T to C, chromosome 6 at 118,613,343 bp
  • A to G, chromosome 7 at 8,481,343 bp
  • A to T, chromosome 7 at 11,517,885 bp
  • G to A, chromosome 7 at 12,906,906 bp
  • A to T, chromosome 7 at 80,309,491 bp
  • T to C, chromosome 7 at 102,454,557 bp
  • C to A, chromosome 7 at 110,039,194 bp
  • T to C, chromosome 7 at 113,299,424 bp
  • C to A, chromosome 7 at 122,170,533 bp
  • ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,713 bp
  • A to G, chromosome 8 at 57,552,518 bp
  • C to G, chromosome 8 at 72,746,441 bp
  • C to A, chromosome 8 at 84,559,293 bp
  • A to T, chromosome 8 at 104,518,239 bp
  • T to G, chromosome 9 at 39,623,972 bp
  • T to C, chromosome 9 at 63,146,448 bp
  • G to T, chromosome 9 at 80,123,728 bp
  • T to A, chromosome 9 at 118,769,111 bp
  • A to G, chromosome 10 at 34,152,565 bp
  • T to C, chromosome 10 at 62,295,745 bp
  • T to A, chromosome 10 at 80,900,544 bp
  • A to G, chromosome 10 at 89,413,901 bp
  • A to T, chromosome 11 at 25,769,014 bp
  • T to A, chromosome 11 at 43,835,967 bp
  • T to A, chromosome 11 at 101,328,377 bp
  • T to C, chromosome 11 at 115,410,266 bp
  • T to C, chromosome 11 at 116,769,184 bp
  • C to A, chromosome 11 at 120,619,011 bp
  • T to C, chromosome 12 at 8,986,000 bp
  • A to T, chromosome 12 at 10,374,903 bp
  • T to C, chromosome 12 at 101,885,435 bp
  • T to A, chromosome 13 at 19,242,846 bp
  • C to T, chromosome 13 at 54,588,604 bp
  • T to C, chromosome 13 at 97,944,686 bp
  • A to C, chromosome 13 at 100,217,071 bp
  • A to T, chromosome 13 at 104,069,323 bp
  • A to T, chromosome 13 at 113,172,001 bp
  • C to T, chromosome 14 at 21,234,929 bp
  • A to G, chromosome 14 at 34,399,417 bp
  • A to T, chromosome 14 at 37,068,910 bp
  • G to A, chromosome 14 at 61,005,205 bp
  • A to T, chromosome 14 at 79,082,814 bp
  • G to C, chromosome 15 at 19,013,359 bp
  • G to A, chromosome 15 at 58,600,432 bp
  • T to C, chromosome 15 at 86,032,518 bp
  • C to T, chromosome 15 at 97,976,159 bp
  • A to G, chromosome 16 at 4,418,809 bp
  • T to C, chromosome 16 at 44,470,748 bp
  • T to A, chromosome 17 at 20,228,565 bp
  • T to G, chromosome 17 at 48,257,941 bp
  • T to A, chromosome 17 at 57,052,822 bp
  • C to A, chromosome 17 at 57,072,379 bp
  • T to C, chromosome 18 at 36,954,636 bp
  • T to C, chromosome 18 at 37,727,430 bp
  • C to T, chromosome 18 at 80,972,705 bp
  • T to C, chromosome 18 at 84,015,641 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7491 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045565-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.