Strain Name:
C57BL/6J-MtgxR7526Btlr/Mmmh
Stock Number:
045598-MU
Citation ID:
RRID:MMRRC_045598-MU
Other Names:
R7526 (G1)
Major Collection:

Strain Information

Pkib
Name: protein kinase inhibitor beta, cAMP dependent, testis specific
Synonyms: Prkacn2, PKIbeta
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18768
HGNC: HGNC:9018
Homologene: 7474
Sod2
Name: superoxide dismutase 2, mitochondrial
Synonyms: manganese superoxide dismutase, manganese SOD, Sod-2, MnSOD
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20656
VEGA: 17
Homologene: 530
Sema3c
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C
Synonyms: Semae, 1110036B02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20348
Homologene: 36201
Card11
Name: caspase recruitment domain family, member 11
Synonyms: 0610008L17Rik, CARMA1, 2410011D02Rik, BIMP3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 108723
Homologene: 13024
Nrg1
Name: neuregulin 1
Synonyms: ARIA, HRGalpha, NDF, D230005F13Rik, HGL, Hgl, HRG, GGFII, SMDF, 6030402G23Rik, heregulin, GGF
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 211323
HGNC: HGNC:7997
Homologene: 138451
Pum1
Name: pumilio RNA-binding family member 1
Synonyms: Pumm
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 80912
Homologene: 22830
Hsp90aa1
Name: heat shock protein 90, alpha (cytosolic), class A member 1
Synonyms: Hsp86-1, Hsp89, hsp4, Hsp90, Hspca
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 15519
HGNC: HGNC:5253
Homologene: 68464
Trim6
Name: tripartite motif-containing 6
Synonyms: D7Ertd684e, C430046K18Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 94088
Homologene: 14381
Sema3f
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F
Synonyms: Semak, Sema IV
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20350
Homologene: 20885
Cnot2
Name: CCR4-NOT transcription complex, subunit 2
Synonyms: 2810470K03Rik, 2600016M12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 72068
HGNC: HGNC:7878
Homologene: 40953
Ccdc9
Name: coiled-coil domain containing 9
Synonyms: 2600011L02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243846
Homologene: 9209
Bicd1
Name: BICD cargo adaptor 1
Synonyms: B830009D06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12121
HGNC: HGNC:1049
Homologene: 37518
Ing3
Name: inhibitor of growth family, member 3
Synonyms: 1300013A07Rik, P47ING3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71777
Homologene: 6804
Aqr
Name: aquarius
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11834
Homologene: 7629
Kif2c
Name: kinesin family member 2C
Synonyms: 4930402F02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73804
HGNC: HGNC:6393
Homologene: 21355
Dmxl2
Name: Dmx-like 2
Synonyms: 6430411K14Rik, E130119P06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235380
HGNC: HGNC:2938
Homologene: 41022
Dzip3
Name: DAZ interacting protein 3, zinc finger
Synonyms: 2A-HUB, 6430549P11Rik, 2310047C04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224170
Homologene: 8771
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: A930005E13Rik, 1810009A16Rik, Zubr1, D930005K06Rik, p600, LOC381562
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69116
Homologene: 10804
Dmkn
Name: dermokine
Synonyms: dermokine, Dmkn, 1110014F24Rik, sk89, sk30, cI-36
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73712
Homologene: 136295
Flrt3
Name: fibronectin leucine rich transmembrane protein 3
Synonyms: C430047I10Rik, 5530600M07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71436
HGNC: HGNC:3762
Homologene: 8322
Nfatc3
Name: nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 3
Synonyms: NFAT4, NFATx, D8Ertd281e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18021
HGNC: HGNC:7777
Homologene: 27827
Fat1
Name: FAT atypical cadherin 1
Synonyms: mFat1, Fath, 2310038E12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14107
HGNC: HGNC:3595
Homologene: 66302
Tenm3
Name: teneurin transmembrane protein 3
Synonyms: Odz3, Ten-m3, 2610100B16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23965
Homologene: 22673
Pnpla7
Name: patatin-like phospholipase domain containing 7
Synonyms: E430013P11Rik, NRE
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241274
Homologene: 62431
Kif18b
Name: kinesin family member 18B
Synonyms: 3000004C01Rik, N-8 kinesin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70218
Homologene: 15214
Enpp1
Name: ectonucleotide pyrophosphatase/phosphodiesterase 1
Synonyms: PC-1, NPP1, Pca, CD203c, twy, Ly-41, Pdnp1, E-NPP1, 4833416E15Rik, Pca-1, Npps
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18605
HGNC: HGNC:3356
Homologene: 38151
Fzd5
Name: frizzled class receptor 5
Synonyms: Fz5, 5330434N09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14367
HGNC: HGNC:4043
Homologene: 2590
Slc25a22
Name: solute carrier family 25 (mitochondrial carrier, glutamate), member 22
Synonyms: 1300006L01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68267
Homologene: 69383
Dnah1
Name: dynein, axonemal, heavy chain 1
Synonyms: MDHC7, B230373P09Rik, E030034C22Rik, G1-415-19, Dnahc1, ferf1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110084
VEGA: 14
HGNC: HGNC:2940
Homologene: 67131
Myo7a
Name: myosin VIIA
Synonyms: Myo7, polka, USH1B, nmf371, Hdb
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17921
HGNC: HGNC:7606
Homologene: 219
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Pico, Acz
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Hgsnat
Name: heparan-alpha-glucosaminide N-acetyltransferase
Synonyms: D8Ertd354e, 9430010M12Rik, Tmem76
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 52120
Homologene: 15586
Ptprd
Name: protein tyrosine phosphatase receptor type D
Synonyms: B230219D21Rik, 1110002J03Rik, 3000002J10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19266
HGNC: HGNC:9668
Slc5a8
Name: solute carrier family 5 (iodide transporter), member 8
Synonyms: SMCT
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216225
VEGA: 10
Homologene: 64832
Eogt
Name: EGF domain specific O-linked N-acetylglucosamine transferase
Synonyms: A130022J15Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101351
Homologene: 65276
Bmpr1b
Name: bone morphogenetic protein receptor, type 1B
Synonyms: BMPR-IB, CFK-43a, Alk6, Acvrlk6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12167
HGNC: HGNC:1077
Homologene: 20322
Cdk5rap3
Name: CDK5 regulatory subunit associated protein 3
Synonyms: HSF-27, OK/SW-cl.114, MST016, IC53, C53, 1810007E24Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 80280
Homologene: 12718
Scn9a
Name: sodium channel, voltage-gated, type IX, alpha
Synonyms: PN1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20274
Homologene: 2237
Pear1
Name: platelet endothelial aggregation receptor 1
Synonyms: Jedi-1, 3110045G13Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73182
Homologene: 12492
Gm19410
Name: predicted gene, 19410
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100502846
Homologene: 132117
Erich6
Name: glutamate rich 6
Synonyms: 4932431H17Rik, Fam194a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 545527
Homologene: 65043
Greb1
Name: gene regulated by estrogen in breast cancer protein
Synonyms: 5730583K22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 268527
Homologene: 8780
Mfsd6l
Name: major facilitator superfamily domain containing 6-like
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 215723
Homologene: 17128
Vmn2r83
Name: vomeronasal 2, receptor 83
Synonyms: EG625029
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 625029
Homologene: 83669
Serping1
Name: serine (or cysteine) peptidase inhibitor, clade G, member 1
Synonyms: C1 inhibitor, C1nh, C1INH
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12258
HGNC: HGNC:1228
Homologene: 44
Ubxn8
Name: UBX domain protein 8
Synonyms: Rep-8, D0H8S2298E, Ubxd6, Rep8h
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 108159
Homologene: 4149
Tmem132d
Name: transmembrane protein 132D
Synonyms: C630028F04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243274
Homologene: 71684
Atp8b5
Name: ATPase, class I, type 8B, member 5
Synonyms: 4930417M19Rik, FetA
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320571
Homologene: 99882
Tpte
Name: transmembrane phosphatase with tensin homology
Synonyms: Pten2, Vsp
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234129
Homologene: 50411
Fam186a
Name: family with sequence similarity 186, member A
Synonyms: 1700030F18Rik, LOC380973
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72277
Cadps2
Name: Ca2+-dependent activator protein for secretion 2
Synonyms: A230044C21Rik, Caps2, cpd2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320405
Homologene: 23060
Mybphl
Name: myosin binding protein H-like
Synonyms: 1110037P11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68753
Homologene: 19221
Tec
Name: tec protein tyrosine kinase
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21682
Homologene: 1302
Vmn2r60
Name: vomeronasal 2, receptor 60
Synonyms: EG637898, Casr-rs3, Gprc2a-rs3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 637898
Homologene: 129683
Grik2
Name: glutamate receptor, ionotropic, kainate 2 (beta 2)
Synonyms: Glurbeta2, Glur-6, C130030K03Rik, Glur6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14806
HGNC: HGNC:4580
Homologene: 40717
Fmn1
Name: formin 1
Synonyms: formin-1, Fmn
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14260
HGNC: HGNC:3768
Homologene: 121778
Armh1
Name: armadillo-like helical domain containing 1
Synonyms: LOC381544, LOC381543, Ncrna00082, Gm1661
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381544
Homologene: 28727
Parp8
Name: poly (ADP-ribose) polymerase family, member 8
Synonyms: 2810430O08Rik, D13Ertd275e
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 52552
VEGA: 13
Homologene: 11621
Serinc2
Name: serine incorporator 2
Synonyms: Tde2l, TDE2, FKSG84, 2310004K20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230779
Homologene: 27797
Sirpb1b
Name: signal-regulatory protein beta 1B
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 668101
Homologene: 82993
Rnf148
Name: ring finger protein 148
Synonyms: 4933432M07Rik, Greul3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71300
Homologene: 82404
Or8k37
Name: olfactory receptor family 8 subfamily K member 37
Synonyms: MOR192-2, Olfr1084, MOR192-3, GA_x6K02T2Q125-48121788-48120847
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258235
Homologene: 104285
Grin3b
Name: glutamate receptor, ionotropic, NMDA3B
Synonyms: NR3B
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 170483
Homologene: 15606
Zpld2
Name: zona pellucida like domain containing 2
Synonyms: Gm7534
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 665186
Homologene: 104039
Or8k22
Name: olfactory receptor family 8 subfamily K member 22
Synonyms: MOR188-2, Olfr1054, GA_x6K02T2Q125-47811880-47810942
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259021
Homologene: 133882
Il18r1
Name: interleukin 18 receptor 1
Synonyms: Il1rrp, Il18ralpha
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16182
HGNC: HGNC:5988
Homologene: 2861
Tex44
Name: testis expressed 44
Synonyms: 1700019O17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71863
Homologene: 51874
Dok3
Name: docking protein 3
Synonyms: p62Dok-like protein
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 27261
VEGA: 13
Homologene: 8448
Or52ae9
Name: olfactory receptor family 52 subfamily AE member 9
Synonyms: Olfr629, GA_x6K02T2PBJ9-6466772-6465828, MOR26-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258818
Homologene: 105159
Ankrd22
Name: ankyrin repeat domain 22
Synonyms: 5430429D21Rik, D19Ertd675e
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 52024
Homologene: 34920
Gm2832
Name: predicted gene 2832
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100040545
Gm14326
Name: predicted gene 14326
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 665211
Homologene: 134324
1700086D15Rik
Name: RIKEN cDNA 1700086D15 gene
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 115487729
Gm21886
Name: predicted gene, 21886
Type: Gene
Species: Mouse
Chromosome: 18
Defb48
Name: defensin beta 48
Synonyms: EG432867
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 432867
Homologene: 123941
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 40,471,772 bp
  • G to T, chromosome 1 at 64,736,092 bp
  • G to A, chromosome 1 at 86,426,515 bp
  • A to G, chromosome 1 at 150,656,573 bp
  • A to G, chromosome 2 at 24,998,666 bp
  • A to C, chromosome 2 at 66,483,646 bp
  • A to T, chromosome 2 at 84,767,293 bp
  • A to T, chromosome 2 at 86,333,353 bp
  • A to G, chromosome 2 at 86,639,669 bp
  • A to C, chromosome 2 at 113,688,134 bp
  • A to T, chromosome 2 at 114,108,109 bp
  • T to A, chromosome 2 at 140,660,206 bp
  • G to A, chromosome 2 at 177,946,505 bp
  • A to T, chromosome 3 at 15,548,872 bp
  • A to T, chromosome 3 at 58,630,689 bp
  • A to G, chromosome 3 at 87,752,568 bp
  • A to G, chromosome 3 at 108,374,180 bp
  • A to T, chromosome 3 at 141,856,599 bp
  • A to G, chromosome 4 at 43,366,609 bp
  • T to A, chromosome 4 at 76,066,327 bp
  • A to T, chromosome 4 at 117,182,432 bp
  • C to A, chromosome 4 at 117,213,741 bp
  • T to A, chromosome 4 at 130,258,790 bp
  • T to C, chromosome 4 at 130,747,026 bp
  • T to C, chromosome 4 at 134,200,073 bp
  • G to C, chromosome 4 at 139,422,417 bp
  • A to T, chromosome 4 at 143,965,817 bp
  • T to C, chromosome 5 at 14,521,062 bp
  • A to T, chromosome 5 at 17,727,596 bp
  • T to C, chromosome 5 at 72,786,019 bp
  • A to T, chromosome 5 at 127,784,141 bp
  • A to T, chromosome 5 at 140,913,429 bp
  • G to A, chromosome 6 at 21,953,799 bp
  • T to C, chromosome 6 at 23,496,851 bp
  • G to A, chromosome 6 at 23,654,284 bp
  • A to G, chromosome 6 at 97,113,952 bp
  • T to G, chromosome 6 at 149,513,726 bp
  • A to G, chromosome 7 at 16,282,400 bp
  • A to G, chromosome 7 at 30,777,651 bp
  • AG to A, chromosome 7 at 42,195,734 bp
  • G to T, chromosome 7 at 98,085,448 bp
  • T to C, chromosome 7 at 103,740,400 bp
  • T to A, chromosome 7 at 104,232,832 bp
  • T to C, chromosome 7 at 141,431,383 bp
  • G to A, chromosome 8 at 22,325,547 bp
  • A to G, chromosome 8 at 25,971,049 bp
  • T to C, chromosome 8 at 31,818,323 bp
  • A to T, chromosome 8 at 33,633,607 bp
  • G to A, chromosome 8 at 35,790,612 bp
  • G to A, chromosome 8 at 45,023,427 bp
  • A to T, chromosome 8 at 48,287,812 bp
  • T to C, chromosome 8 at 106,079,083 bp
  • A to G, chromosome 9 at 54,400,957 bp
  • A to T, chromosome 9 at 107,689,728 bp
  • T to C, chromosome 10 at 24,674,410 bp
  • A to T, chromosome 10 at 49,523,822 bp
  • A to G, chromosome 10 at 57,736,298 bp
  • A to G, chromosome 10 at 79,491,558 bp
  • A to G, chromosome 10 at 79,973,051 bp
  • A to G, chromosome 10 at 88,902,491 bp
  • A to T, chromosome 10 at 116,507,080 bp
  • A to T, chromosome 11 at 65,152,981 bp
  • T to C, chromosome 11 at 68,558,038 bp
  • A to T, chromosome 11 at 96,909,945 bp
  • T to C, chromosome 11 at 102,914,667 bp
  • G to A, chromosome 12 at 16,716,765 bp
  • A to T, chromosome 12 at 110,695,294 bp
  • C to T, chromosome 13 at 55,527,493 bp
  • T to C, chromosome 13 at 116,894,805 bp
  • A to T, chromosome 14 at 31,287,876 bp
  • A to T, chromosome 14 at 41,280,962 bp
  • A to G, chromosome 14 at 62,977,831 bp
  • G to C, chromosome 15 at 99,941,915 bp
  • A to T, chromosome 16 at 48,975,474 bp
  • G to T, chromosome 17 at 13,008,031 bp
  • ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG to ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG, chromosome 18 at 80,089,825 bp
  • A to T, chromosome 19 at 34,149,365 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7526 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045598-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.