Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7526Btlr/Mmmh
Stock Number:
045598-MU
Citation ID:
RRID:MMRRC_045598-MU
Other Names:
R7526 (G1)
Major Collection:

Strain Information

Pkib
Name: protein kinase inhibitor beta, cAMP dependent, testis specific
Synonyms: PKIbeta, Prkacn2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18768
HGNC: HGNC:9018
Homologene: 7474
Sod2
Name: superoxide dismutase 2, mitochondrial
Synonyms: MnSOD, manganese SOD, manganese superoxide dismutase, Sod-2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20656
VEGA: 17
Homologene: 530
Sema3c
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C
Synonyms: Semae, 1110036B02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20348
Homologene: 36201
Card11
Name: caspase recruitment domain family, member 11
Synonyms: CARMA1, BIMP3, 2410011D02Rik, 0610008L17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 108723
Homologene: 13024
Nrg1
Name: neuregulin 1
Synonyms: HGL, HRG, Hgl, SMDF, GGF, ARIA, heregulin, D230005F13Rik, HRGalpha, 6030402G23Rik, GGFII, NDF
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 211323
HGNC: HGNC:7997
Homologene: 138451
Hsp90aa1
Name: heat shock protein 90, alpha (cytosolic), class A member 1
Synonyms: hsp4, Hsp90, Hsp86-1, Hsp89, Hspca
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 15519
Homologene: 68464
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 40,471,772 bp
  • G to T, chromosome 1 at 64,736,092 bp
  • G to A, chromosome 1 at 86,426,515 bp
  • A to G, chromosome 1 at 150,656,573 bp
  • A to G, chromosome 2 at 24,998,666 bp
  • A to C, chromosome 2 at 66,483,646 bp
  • A to T, chromosome 2 at 84,767,293 bp
  • A to T, chromosome 2 at 86,333,353 bp
  • A to G, chromosome 2 at 86,639,669 bp
  • A to C, chromosome 2 at 113,688,134 bp
  • A to T, chromosome 2 at 114,108,109 bp
  • T to A, chromosome 2 at 140,660,206 bp
  • G to A, chromosome 2 at 177,946,505 bp
  • A to T, chromosome 3 at 15,548,872 bp
  • A to T, chromosome 3 at 58,630,689 bp
  • A to G, chromosome 3 at 87,752,568 bp
  • A to G, chromosome 3 at 108,374,180 bp
  • A to T, chromosome 3 at 141,856,599 bp
  • A to G, chromosome 4 at 43,366,609 bp
  • T to A, chromosome 4 at 76,066,327 bp
  • A to T, chromosome 4 at 117,182,432 bp
  • C to A, chromosome 4 at 117,213,741 bp
  • T to A, chromosome 4 at 130,258,790 bp
  • T to C, chromosome 4 at 130,747,026 bp
  • T to C, chromosome 4 at 134,200,073 bp
  • G to C, chromosome 4 at 139,422,417 bp
  • A to T, chromosome 4 at 143,965,817 bp
  • T to C, chromosome 5 at 14,521,062 bp
  • A to T, chromosome 5 at 17,727,596 bp
  • T to C, chromosome 5 at 72,786,019 bp
  • A to T, chromosome 5 at 127,784,141 bp
  • A to T, chromosome 5 at 140,913,429 bp
  • G to A, chromosome 6 at 21,953,799 bp
  • T to C, chromosome 6 at 23,496,851 bp
  • G to A, chromosome 6 at 23,654,284 bp
  • A to G, chromosome 6 at 97,113,952 bp
  • T to G, chromosome 6 at 149,513,726 bp
  • A to G, chromosome 7 at 16,282,400 bp
  • A to G, chromosome 7 at 30,777,651 bp
  • AG to A, chromosome 7 at 42,195,734 bp
  • G to T, chromosome 7 at 98,085,448 bp
  • T to C, chromosome 7 at 103,740,400 bp
  • T to A, chromosome 7 at 104,232,832 bp
  • T to C, chromosome 7 at 141,431,383 bp
  • G to A, chromosome 8 at 22,325,547 bp
  • A to G, chromosome 8 at 25,971,049 bp
  • T to C, chromosome 8 at 31,818,323 bp
  • A to T, chromosome 8 at 33,633,607 bp
  • G to A, chromosome 8 at 35,790,612 bp
  • G to A, chromosome 8 at 45,023,427 bp
  • A to T, chromosome 8 at 48,287,812 bp
  • T to C, chromosome 8 at 106,079,083 bp
  • A to G, chromosome 9 at 54,400,957 bp
  • A to T, chromosome 9 at 107,689,728 bp
  • T to C, chromosome 10 at 24,674,410 bp
  • A to T, chromosome 10 at 49,523,822 bp
  • A to G, chromosome 10 at 57,736,298 bp
  • A to G, chromosome 10 at 79,491,558 bp
  • A to G, chromosome 10 at 79,973,051 bp
  • A to G, chromosome 10 at 88,902,491 bp
  • A to T, chromosome 10 at 116,507,080 bp
  • A to T, chromosome 11 at 65,152,981 bp
  • T to C, chromosome 11 at 68,558,038 bp
  • A to T, chromosome 11 at 96,909,945 bp
  • T to C, chromosome 11 at 102,914,667 bp
  • G to A, chromosome 12 at 16,716,765 bp
  • A to T, chromosome 12 at 110,695,294 bp
  • C to T, chromosome 13 at 55,527,493 bp
  • T to C, chromosome 13 at 116,894,805 bp
  • A to T, chromosome 14 at 31,287,876 bp
  • A to T, chromosome 14 at 41,280,962 bp
  • A to G, chromosome 14 at 62,977,831 bp
  • G to C, chromosome 15 at 99,941,915 bp
  • A to T, chromosome 16 at 48,975,474 bp
  • G to T, chromosome 17 at 13,008,031 bp
  • ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG to ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG, chromosome 18 at 80,089,825 bp
  • A to T, chromosome 19 at 34,149,365 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7526 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045598-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.