Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7536Btlr/Mmmh
Stock Number:
045608-MU
Citation ID:
RRID:MMRRC_045608-MU
Other Names:
R7536 (G1)
Major Collection:

Strain Information

Stx1a
Name: syntaxin 1A (brain)
Synonyms: HPC-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20907
Homologene: 37941
Gria4
Name: glutamate receptor, ionotropic, AMPA4 (alpha 4)
Synonyms: Glur-4, Glur4, spkw1, Gluralpha4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14802
HGNC: HGNC:4574
Homologene: 20227
Ttc39b
Name: tetratricopeptide repeat domain 39B
Synonyms: 9130422G05Rik, 1810054D07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69863
Homologene: 25228
Ppp6r3
Name: protein phosphatase 6, regulatory subunit 3
Synonyms: 9130026N02Rik, D19Bwg1430e, 4930528G08Rik, D19Ertd703e, Pp6r3, Pptcs3, Saps3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 52036
VEGA: 19
HGNC: HGNC:1173
Homologene: 115911
Fbxl20
Name: F-box and leucine-rich repeat protein 20
Synonyms: C86145, Fbl2, 2610511F20Rik, 4632423N09Rik, Scr, Scrapper
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72194
Homologene: 68784
Kif5b
Name: kinesin family member 5B
Synonyms: Khc, kinesin heavy chain
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16573
HGNC: HGNC:6324
Homologene: 55829
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to G, chromosome 1 at 43,111,345 bp
  • C to T, chromosome 1 at 55,713,481 bp
  • A to G, chromosome 1 at 78,443,754 bp
  • A to G, chromosome 1 at 128,182,211 bp
  • T to C, chromosome 1 at 149,880,017 bp
  • A to G, chromosome 2 at 25,537,106 bp
  • T to C, chromosome 2 at 76,717,337 bp
  • C to T, chromosome 2 at 87,269,599 bp
  • T to A, chromosome 2 at 120,018,585 bp
  • T to A, chromosome 2 at 121,096,397 bp
  • T to A, chromosome 2 at 176,810,929 bp
  • A to T, chromosome 3 at 79,827,657 bp
  • C to A, chromosome 3 at 96,890,893 bp
  • A to G, chromosome 3 at 97,757,244 bp
  • A to T, chromosome 3 at 142,566,395 bp
  • T to A, chromosome 4 at 24,581,240 bp
  • G to A, chromosome 4 at 59,914,141 bp
  • C to A, chromosome 4 at 82,884,968 bp
  • A to G, chromosome 4 at 82,956,195 bp
  • A to T, chromosome 4 at 83,239,978 bp
  • C to A, chromosome 4 at 96,535,537 bp
  • T to A, chromosome 4 at 112,811,547 bp
  • A to G, chromosome 4 at 133,295,250 bp
  • A to G, chromosome 5 at 29,757,806 bp
  • A to G, chromosome 5 at 34,543,557 bp
  • A to T, chromosome 5 at 86,124,332 bp
  • C to A, chromosome 5 at 113,845,289 bp
  • T to C, chromosome 5 at 135,049,840 bp
  • C to G, chromosome 6 at 17,886,020 bp
  • A to T, chromosome 6 at 24,100,331 bp
  • T to C, chromosome 6 at 125,192,567 bp
  • T to A, chromosome 6 at 132,207,221 bp
  • T to C, chromosome 7 at 25,307,869 bp
  • T to G, chromosome 7 at 26,840,478 bp
  • C to A, chromosome 7 at 105,709,561 bp
  • A to G, chromosome 7 at 120,201,108 bp
  • A to G, chromosome 7 at 131,568,703 bp
  • T to C, chromosome 7 at 141,160,812 bp
  • T to C, chromosome 8 at 85,353,604 bp
  • A to T, chromosome 8 at 105,977,400 bp
  • A to C, chromosome 9 at 4,464,298 bp
  • C to A, chromosome 9 at 20,101,530 bp
  • A to T, chromosome 9 at 22,670,800 bp
  • C to T, chromosome 9 at 95,762,057 bp
  • ACA to ACATCTTCCCAAAGCCAGTCA, chromosome 11 at 3,153,382 bp
  • G to T, chromosome 11 at 70,137,007 bp
  • A to T, chromosome 11 at 98,095,383 bp
  • G to A, chromosome 11 at 98,712,621 bp
  • A to T, chromosome 12 at 16,682,185 bp
  • A to G, chromosome 12 at 77,475,078 bp
  • T to A, chromosome 13 at 4,063,690 bp
  • C to T, chromosome 13 at 59,741,742 bp
  • G to T, chromosome 14 at 49,774,246 bp
  • A to G, chromosome 14 at 76,504,763 bp
  • G to T, chromosome 15 at 36,161,851 bp
  • A to G, chromosome 15 at 100,675,364 bp
  • A to G, chromosome 16 at 10,638,844 bp
  • T to G, chromosome 16 at 96,641,026 bp
  • T to A, chromosome 17 at 34,958,875 bp
  • G to T, chromosome 17 at 36,943,117 bp
  • T to C, chromosome 17 at 75,514,133 bp
  • A to T, chromosome 18 at 6,216,235 bp
  • A to G, chromosome 18 at 58,556,626 bp
  • G to C, chromosome 18 at 60,829,051 bp
  • T to C, chromosome 19 at 3,507,341 bp
  • G to A, chromosome 19 at 34,252,531 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7536 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045608-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.