Strain Name:
C57BL/6J-MtgxR7536Btlr/Mmmh
Stock Number:
045608-MU
Citation ID:
RRID:MMRRC_045608-MU
Other Names:
R7536 (G1)
Major Collection:

Strain Information

Stx1a
Name: syntaxin 1A (brain)
Synonyms: HPC-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20907
Homologene: 37941
Crym
Name: crystallin, mu
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12971
HGNC: HGNC:2418
Homologene: 1424
Gria4
Name: glutamate receptor, ionotropic, AMPA4 (alpha 4)
Synonyms: Glur4, spkw1, Gluralpha4, Glur-4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14802
HGNC: HGNC:4574
Homologene: 20227
Ttc39b
Name: tetratricopeptide repeat domain 39B
Synonyms: 1810054D07Rik, 9130422G05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69863
Homologene: 25228
Ppp6r3
Name: protein phosphatase 6, regulatory subunit 3
Synonyms: Pptcs3, Pp6r3, 4930528G08Rik, Saps3, D19Bwg1430e, D19Ertd703e, 9130026N02Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 52036
VEGA: 19
HGNC: HGNC:1173
Homologene: 115911
Fbxl20
Name: F-box and leucine-rich repeat protein 20
Synonyms: C86145, 2610511F20Rik, 4632423N09Rik, Fbl2, Scr, Scrapper
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72194
Homologene: 68784
Kif5b
Name: kinesin family member 5B
Synonyms: Khc, kinesin heavy chain
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16573
HGNC: HGNC:6324
Homologene: 55829
Bub3
Name: BUB3 mitotic checkpoint protein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12237
HGNC: HGNC:1151
Homologene: 3470
R3hdm1
Name: R3H domain containing 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226412
HGNC: HGNC:9757
Homologene: 9108
Tsc22d1
Name: TSC22 domain family, member 1
Synonyms: Egr5, Tgfb1i4, TSC-22
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21807
Homologene: 7573
Coro1c
Name: coronin, actin binding protein 1C
Synonyms: CRN2, coronin 3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23790
HGNC: HGNC:2254
Homologene: 56537
Traf2
Name: TNF receptor-associated factor 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22030
Homologene: 22520
Tcof1
Name: treacle ribosome biogenesis factor 1
Synonyms: treacle
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 21453
Homologene: 68049
Clec16a
Name: C-type lectin domain family 16, member A
Synonyms: 4932416N17Rik, curt
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74374
Homologene: 71019
Rnf39
Name: ring finger protein 39
Synonyms: LOC386465, LOC386454, LIRF, LOC240094
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 386454
Homologene: 11891
St7
Name: suppression of tumorigenicity 7
Synonyms: SEN4, 9430001H04Rik, Fam4a2, RAY1, TSG7, HELG
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 64213
Homologene: 10185
Mms22l
Name: MMS22-like, DNA repair protein
Synonyms: F730047E07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 212377
Homologene: 18874
Frem1
Name: Fras1 related extracellular matrix protein 1
Synonyms: heb, eyem02Jus, eyes2, QBRICK, crf11
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329872
Homologene: 27049
Uba6
Name: ubiquitin-like modifier activating enzyme 6
Synonyms: 5730469D23Rik, Ube1l2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231380
Homologene: 10080
Bbs9
Name: Bardet-Biedl syndrome 9
Synonyms: EST 3159894, E130103I17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319845
Homologene: 44480
Gpr89
Name: G protein-coupled receptor 89
Synonyms: SH120, 4933412D19Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67549
Homologene: 9475
Dnajb6
Name: DnaJ heat shock protein family (Hsp40) member B6
Synonyms: mDj4, Mrj
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23950
Homologene: 38058
Farsb
Name: phenylalanyl-tRNA synthetase, beta subunit
Synonyms: Farslb, Farsl, PheRS alpha, Frsb
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23874
Homologene: 4160
Fut8
Name: fucosyltransferase 8
Synonyms: alpha (1,6) fucosyltransferase
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 53618
VEGA: 12
HGNC: HGNC:4019
Homologene: 9650
Mrpl51
Name: mitochondrial ribosomal protein L51
Synonyms: Mrp64, HSPC241, 2610511M02Rik, CDA09
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66493
Homologene: 32317
Wdtc1
Name: WD and tetratricopeptide repeats 1
Synonyms: adipose, LOC230796, adp
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230796
Homologene: 8997
Mgl2
Name: macrophage galactose N-acetyl-galactosamine specific lectin 2
Synonyms: CD301b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216864
Homologene: 7836
Armh4
Name: armadillo-like helical domain containing 4
Synonyms: 3632451O06Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67419
Homologene: 12127
Dnhd1
Name: dynein heavy chain domain 1
Synonyms: 8030491N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77505
Homologene: 131117
Hspa1b
Name: heat shock protein 1B
Synonyms: Hsp70.1, HSP70B1, hsp68, Hsp70-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15511
HGNC: HGNC:5233
Homologene: 133785
Acta2
Name: actin alpha 2, smooth muscle, aorta
Synonyms: SMAalpha, SMalphaA, Actvs, 0610041G09Rik, alphaSMA, a-SMA
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 11475
VEGA: 19
HGNC: HGNC:130
Homologene: 133938
Ttn
Name: titin
Synonyms: shru, L56, mdm, connectin, D330041I19Rik, 2310057K23Rik, 2310074I15Rik, 2310036G12Rik, D830007G01Rik, 1100001C23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Rasgrp3
Name: RAS, guanyl releasing protein 3
Synonyms: LOC240168
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240168
VEGA: 17
Homologene: 15019
Mylk3
Name: myosin light chain kinase 3
Synonyms: D830007F02Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 213435
Homologene: 35278
Slc46a2
Name: solute carrier family 46, member 2
Synonyms: Ly110, Tscot, 5430429N04Rik, TSO-1C12
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 30936
Homologene: 23273
Dscam
Name: DS cell adhesion molecule
Synonyms: Down syndrome cell adhesion molecule, 4932410A21Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13508
HGNC: HGNC:3039
Homologene: 74393
Pls1
Name: plastin 1 (I-isoform)
Synonyms: I-fimbrin
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102502
HGNC: HGNC:9090
Homologene: 68270
Skint6
Name: selection and upkeep of intraepithelial T cells 6
Synonyms: OTTMUSG00000008519
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230622
Homologene: 135888
Tgm7
Name: transglutaminase 7
Synonyms: TGz
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 640543
Homologene: 14192
Rnh1
Name: ribonuclease/angiogenin inhibitor 1
Synonyms: RNH
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 107702
Homologene: 2204
Plcl1
Name: phospholipase C-like 1
Synonyms: C230017K02Rik, PLC-L, PRIP-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227120
HGNC: HGNC:9063
Homologene: 38155
Pde4dip
Name: phosphodiesterase 4D interacting protein (myomegalin)
Synonyms: D3Bwg1078e, D130016K21Rik, 9430063L05Rik, Usmg4, 4732458A06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 83679
Homologene: 66961
Tmem144
Name: transmembrane protein 144
Synonyms: 5730537D05Rik, 1110057I03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70652
Homologene: 41250
Sfi1
Name: Sfi1 homolog, spindle assembly associated (yeast)
Synonyms: 2310047I15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78887
Homologene: 12707
Greb1
Name: gene regulated by estrogen in breast cancer protein
Synonyms: 5730583K22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 268527
Homologene: 8780
Tmem145
Name: transmembrane protein 145
Synonyms: B930076A02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330485
Homologene: 18333
Slc27a6
Name: solute carrier family 27 (fatty acid transporter), member 6
Synonyms: FATP6, 4732438L20Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225579
Homologene: 38385
Cyp2j6
Name: cytochrome P450, family 2, subfamily j, polypeptide 6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13110
HGNC: HGNC:2634
Homologene: 68091
Pla2g4a
Name: phospholipase A2, group IVA (cytosolic, calcium-dependent)
Synonyms: cytosolic PLA2, cytosolic phospholipase A2, cPLA2, Pla2g4, cPLA2alpha, Type IV PLA2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18783
HGNC: HGNC:9035
Homologene: 32059
Mapkbp1
Name: mitogen-activated protein kinase binding protein 1
Synonyms: 2810483F24Rik, Jnkbp1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26390
Homologene: 69109
Gbp3
Name: guanylate binding protein 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 55932
Homologene: 137329
Fbxo43
Name: F-box protein 43
Synonyms: 4930533G20Rik, endogenous meiotic inhibitor 2, Emi2, XErp1 homolog, early mitotic inhibitor 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78803
VEGA: 15
Homologene: 66393
Slc13a1
Name: solute carrier family 13 (sodium/sulfate symporters), member 1
Synonyms: NaSi-1, Nas1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 55961
Homologene: 31893
AI597479
Name: expressed sequence AI597479
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98404
Homologene: 11459
Prb1a
Name: proline-rich protein BstNI subfamily 1A
Synonyms: Prb1, proline-rich proteoglycan 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381833
Or7e174
Name: olfactory receptor family 7 subfamily E member 174
Synonyms: Olfr868, MOR145-4, GA_x6K02T2PVTD-13841888-13842802
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258552
HGNC: HGNC:8396
Homologene: 74168
Dpep3
Name: dipeptidase 3
Synonyms: MBD-3, 1700018F16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71854
Homologene: 23357
Akr1c14
Name: aldo-keto reductase family 1, member C14
Synonyms: 9030611N15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105387
Homologene: 138093
Sh3bp2
Name: SH3-domain binding protein 2
Synonyms: 3BP2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 24055
Homologene: 2276
Cyp2a5
Name: cytochrome P450, family 2, subfamily a, polypeptide 5
Synonyms: Coh
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13087
Homologene: 85917
Spata31d1e
Name: spermatogenesis associated 31 subfamily D, member 1E
Synonyms: 1700014D04Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 102638268
Homologene: 140986
Med24
Name: mediator complex subunit 24
Synonyms: DRIP100, Trap100, Gse2, Pparb2, R75526, D11Ertd307e, Thrap4, 100kDa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23989
Homologene: 40795
Gm14295
Name: predicted gene 14295
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100039123
Homologene: 133105
Cela1
Name: chymotrypsin-like elastase family, member 1
Synonyms: Ela-1, 1810062B19Rik, Ela1, PC-TsF, 1810009A17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 109901
VEGA: 15
HGNC: HGNC:3308
Homologene: 20454
Cer1
Name: cerberus 1, DAN family BMP antagonist
Synonyms: cer-1, Cerr1, Cerl1, Cerberus-like, Cerl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12622
HGNC: HGNC:1862
Homologene: 3983
Or10ag54
Name: olfactory receptor family 10 subfamily AG member 54
Synonyms: GA_x6K02T2Q125-48753766-48754734, Olfr1116-ps, Olfr1116, Olfr1521-ps1, MOR264-21P, MOR264-8P
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257875
Homologene: 134077
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to G, chromosome 1 at 43,111,345 bp
  • C to T, chromosome 1 at 55,713,481 bp
  • A to G, chromosome 1 at 78,443,754 bp
  • A to G, chromosome 1 at 128,182,211 bp
  • T to C, chromosome 1 at 149,880,017 bp
  • A to G, chromosome 2 at 25,537,106 bp
  • T to C, chromosome 2 at 76,717,337 bp
  • C to T, chromosome 2 at 87,269,599 bp
  • T to A, chromosome 2 at 120,018,585 bp
  • T to A, chromosome 2 at 121,096,397 bp
  • T to A, chromosome 2 at 176,810,929 bp
  • A to T, chromosome 3 at 79,827,657 bp
  • C to A, chromosome 3 at 96,890,893 bp
  • A to G, chromosome 3 at 97,757,244 bp
  • A to T, chromosome 3 at 142,566,395 bp
  • T to A, chromosome 4 at 24,581,240 bp
  • G to A, chromosome 4 at 59,914,141 bp
  • C to A, chromosome 4 at 82,884,968 bp
  • A to G, chromosome 4 at 82,956,195 bp
  • A to T, chromosome 4 at 83,239,978 bp
  • C to A, chromosome 4 at 96,535,537 bp
  • T to A, chromosome 4 at 112,811,547 bp
  • A to G, chromosome 4 at 133,295,250 bp
  • A to G, chromosome 5 at 29,757,806 bp
  • A to G, chromosome 5 at 34,543,557 bp
  • A to T, chromosome 5 at 86,124,332 bp
  • C to A, chromosome 5 at 113,845,289 bp
  • T to C, chromosome 5 at 135,049,840 bp
  • C to G, chromosome 6 at 17,886,020 bp
  • A to T, chromosome 6 at 24,100,331 bp
  • T to C, chromosome 6 at 125,192,567 bp
  • T to A, chromosome 6 at 132,207,221 bp
  • T to C, chromosome 7 at 25,307,869 bp
  • T to G, chromosome 7 at 26,840,478 bp
  • C to A, chromosome 7 at 105,709,561 bp
  • A to G, chromosome 7 at 120,201,108 bp
  • A to G, chromosome 7 at 131,568,703 bp
  • T to C, chromosome 7 at 141,160,812 bp
  • T to C, chromosome 8 at 85,353,604 bp
  • A to T, chromosome 8 at 105,977,400 bp
  • A to C, chromosome 9 at 4,464,298 bp
  • C to A, chromosome 9 at 20,101,530 bp
  • A to T, chromosome 9 at 22,670,800 bp
  • C to T, chromosome 9 at 95,762,057 bp
  • ACA to ACATCTTCCCAAAGCCAGTCA, chromosome 11 at 3,153,382 bp
  • G to T, chromosome 11 at 70,137,007 bp
  • A to T, chromosome 11 at 98,095,383 bp
  • G to A, chromosome 11 at 98,712,621 bp
  • A to T, chromosome 12 at 16,682,185 bp
  • A to G, chromosome 12 at 77,475,078 bp
  • T to A, chromosome 13 at 4,063,690 bp
  • C to T, chromosome 13 at 59,741,742 bp
  • G to T, chromosome 14 at 49,774,246 bp
  • A to G, chromosome 14 at 76,504,763 bp
  • G to T, chromosome 15 at 36,161,851 bp
  • A to G, chromosome 15 at 100,675,364 bp
  • A to G, chromosome 16 at 10,638,844 bp
  • T to G, chromosome 16 at 96,641,026 bp
  • T to A, chromosome 17 at 34,958,875 bp
  • G to T, chromosome 17 at 36,943,117 bp
  • T to C, chromosome 17 at 75,514,133 bp
  • A to T, chromosome 18 at 6,216,235 bp
  • A to G, chromosome 18 at 58,556,626 bp
  • G to C, chromosome 18 at 60,829,051 bp
  • T to C, chromosome 19 at 3,507,341 bp
  • G to A, chromosome 19 at 34,252,531 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7536 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045608-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.