Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7549Btlr/Mmmh
Stock Number:
045620-MU
Citation ID:
RRID:MMRRC_045620-MU
Other Names:
R7549 (G1)
Major Collection:

Strain Information

Kmt2c
Name: lysine (K)-specific methyltransferase 2C
Synonyms: E330008K23Rik, HALR, Mll3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231051
Homologene: 46480
Mbd5
Name: methyl-CpG binding domain protein 5
Synonyms: 9430004D19Rik, C030040A15Rik, OTTMUSG00000012483
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 109241
Homologene: 81861
Magi1
Name: membrane associated guanylate kinase, WW and PDZ domain containing 1
Synonyms: WWP3, Gukmi1, AIP3, BAP1, Baiap1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14924
HGNC: HGNC:946
Homologene: 31257
Tmed10
Name: transmembrane p24 trafficking protein 10
Synonyms: 1110014C03Rik, p24delta1, p23
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68581
VEGA: 12
Homologene: 4972
Tti1
Name: TELO2 interacting protein 1
Synonyms: 2610036D13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75425
Homologene: 40969
Efr3a
Name: EFR3 homolog A
Synonyms: A130089M23Rik, D030063F01Rik, C920006C10Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 76740
Homologene: 44222
Ptpn5
Name: protein tyrosine phosphatase, non-receptor type 5
Synonyms: Step
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19259
HGNC: HGNC:9657
Homologene: 8423
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 30,831,475 bp
  • G to T, chromosome 2 at 25,574,832 bp
  • C to T, chromosome 2 at 40,875,122 bp
  • T to A, chromosome 2 at 49,251,343 bp
  • T to A, chromosome 2 at 49,701,093 bp
  • A to G, chromosome 2 at 52,078,507 bp
  • A to G, chromosome 2 at 67,508,897 bp
  • A to T, chromosome 2 at 82,993,993 bp
  • A to T, chromosome 2 at 87,711,771 bp
  • T to C, chromosome 2 at 125,344,027 bp
  • A to G, chromosome 2 at 157,269,572 bp
  • A to G, chromosome 2 at 158,007,168 bp
  • G to A, chromosome 2 at 172,426,798 bp
  • G to T, chromosome 2 at 172,426,799 bp
  • T to A, chromosome 3 at 33,082,035 bp
  • A to T, chromosome 3 at 89,150,000 bp
  • A to T, chromosome 3 at 93,773,016 bp
  • C to A, chromosome 4 at 21,679,072 bp
  • A to T, chromosome 4 at 88,816,427 bp
  • T to C, chromosome 4 at 123,105,655 bp
  • T to C, chromosome 5 at 23,815,704 bp
  • T to C, chromosome 5 at 25,414,970 bp
  • T to G, chromosome 5 at 76,208,568 bp
  • T to G, chromosome 5 at 90,606,802 bp
  • A to G, chromosome 5 at 92,403,655 bp
  • A to G, chromosome 5 at 121,501,918 bp
  • AGCCGGCC to AGCC, chromosome 6 at 17,099,741 bp
  • A to G, chromosome 6 at 24,559,030 bp
  • T to G, chromosome 6 at 93,708,114 bp
  • A to G, chromosome 6 at 125,626,267 bp
  • G to T, chromosome 7 at 43,812,773 bp
  • C to T, chromosome 7 at 47,086,126 bp
  • T to C, chromosome 7 at 65,647,593 bp
  • T to C, chromosome 7 at 82,573,909 bp
  • T to C, chromosome 7 at 89,407,138 bp
  • C to A, chromosome 7 at 97,738,077 bp
  • T to C, chromosome 7 at 102,948,591 bp
  • A to G, chromosome 7 at 114,554,644 bp
  • T to A, chromosome 8 at 35,799,346 bp
  • A to T, chromosome 8 at 44,988,994 bp
  • T to A, chromosome 8 at 92,836,966 bp
  • T to A, chromosome 8 at 104,498,084 bp
  • A to G, chromosome 9 at 7,384,753 bp
  • T to A, chromosome 9 at 40,802,959 bp
  • T to C, chromosome 9 at 62,060,993 bp
  • T to C, chromosome 9 at 75,637,237 bp
  • T to A, chromosome 9 at 76,198,975 bp
  • A to C, chromosome 9 at 97,582,544 bp
  • T to C, chromosome 9 at 108,114,815 bp
  • T to C, chromosome 10 at 13,542,670 bp
  • A to T, chromosome 10 at 23,111,658 bp
  • G to A, chromosome 10 at 52,145,834 bp
  • T to A, chromosome 10 at 84,374,539 bp
  • T to C, chromosome 10 at 103,389,137 bp
  • T to C, chromosome 10 at 130,210,984 bp
  • T to A, chromosome 10 at 130,446,828 bp
  • C to A, chromosome 11 at 59,042,838 bp
  • C to T, chromosome 11 at 98,690,961 bp
  • T to C, chromosome 11 at 99,145,901 bp
  • G to T, chromosome 12 at 70,346,941 bp
  • A to T, chromosome 12 at 81,314,770 bp
  • G to T, chromosome 12 at 85,344,262 bp
  • A to G, chromosome 13 at 11,737,985 bp
  • G to A, chromosome 13 at 21,484,249 bp
  • A to T, chromosome 13 at 27,318,971 bp
  • G to T, chromosome 13 at 31,558,995 bp
  • A to G, chromosome 14 at 55,705,903 bp
  • C to A, chromosome 14 at 121,235,177 bp
  • T to A, chromosome 15 at 65,815,413 bp
  • T to A, chromosome 15 at 85,819,793 bp
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp
  • T to C, chromosome 16 at 33,799,436 bp
  • A to C, chromosome 16 at 95,369,320 bp
  • T to C, chromosome 17 at 20,962,682 bp
  • T to A, chromosome 17 at 25,567,961 bp
  • G to A, chromosome 17 at 35,848,857 bp
  • G to A, chromosome 17 at 57,033,791 bp
  • A to T, chromosome 17 at 64,309,415 bp
  • A to G, chromosome 17 at 67,871,966 bp
  • A to T, chromosome 18 at 58,020,464 bp
  • T to C, chromosome 18 at 74,200,017 bp
  • A to T, chromosome 19 at 3,996,651 bp
  • A to G, chromosome 19 at 40,564,847 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7549 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045620-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.