Strain Name:
C57BL/6J-MtgxR7553Btlr/Mmmh
Stock Number:
045622-MU
Citation ID:
RRID:MMRRC_045622-MU
Other Names:
R7553 (G1)
Major Collection:

Strain Information

Dntt
Name: deoxynucleotidyltransferase, terminal
Synonyms: Tdt
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21673
VEGA: 19
HGNC: HGNC:2983
Homologene: 3014
Ccne2
Name: cyclin E2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12448
HGNC: HGNC:1590
Homologene: 7660
Csnk1e
Name: casein kinase 1, epsilon
Synonyms: KC1epsilon, CK1epsilon, CKI epsilon, tau, CKIepsilon
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 27373
Homologene: 121695
Pck1
Name: phosphoenolpyruvate carboxykinase 1, cytosolic
Synonyms: PEPCK, Pck-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18534
HGNC: HGNC:8724
Homologene: 1944
Avp
Name: arginine vasopressin
Synonyms: Vp, Vsp
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11998
HGNC: HGNC:894
Homologene: 417
Morc3
Name: microrchidia 3
Synonyms: D16Jhu32e, 1110051N18Rik, Zcwcc3, 1110051N18Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 338467
Homologene: 32257
Prep
Name: prolyl endopeptidase
Synonyms: Pop, prolyl oligopeptidase, D10Wsu136e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19072
VEGA: 10
HGNC: HGNC:9358
Homologene: 2042
Rybp
Name: RING1 and YY1 binding protein
Synonyms: DEDAF, 2410018J24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56353
Homologene: 8159
Nln
Name: neurolysin (metallopeptidase M3 family)
Synonyms: 4930472G13Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75805
VEGA: 13
Homologene: 69315
Nup205
Name: nucleoporin 205
Synonyms: 3830404O05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70699
Homologene: 45971
Setdb1
Name: SET domain, bifurcated 1
Synonyms: ESET, KMT1E
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 84505
Homologene: 32157
Tex264
Name: testis expressed gene 264 ER-phagy receptor
Synonyms: TEG-264
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21767
Homologene: 7975
Urb1
Name: URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Synonyms: 4921511H13Rik, 5730405K23Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207932
Homologene: 45941
S100a10
Name: S100 calcium binding protein A10 (calpactin)
Synonyms: p10, 42C, CLP11, CAL12, Cal1l
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20194
Homologene: 2228
Rad17
Name: RAD17 checkpoint clamp loader component
Synonyms: MmRad24, 9430035O09Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19356
VEGA: 13
HGNC: HGNC:9807
Homologene: 32117
Dmbt1
Name: deleted in malignant brain tumors 1
Synonyms: MUCLIN, CRP-[b], hensin, ebnerin, Crpd, vomeroglandin, CRP-[a], gp300
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12945
HGNC: HGNC:2926
Homologene: 68990
Mcf2l
Name: mcf.2 transforming sequence-like
Synonyms: C130040G20Rik, Dbs
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17207
Homologene: 11804
Pianp
Name: PILR alpha associated neural protein
Synonyms: C530028O21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 319352
Homologene: 17799
Zfp37
Name: zinc finger protein 37
Synonyms: Tzn, Zfp-37
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22696
Homologene: 40682
Homer3
Name: homer scaffolding protein 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 26558
Homologene: 37972
Retreg3
Name: reticulophagy regulator family member 3
Synonyms: 4933404C01Rik, 1300010M03Rik, Fam134c
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67998
Homologene: 23585
Dlk1
Name: delta like non-canonical Notch ligand 1
Synonyms: ZOG, Peg9, pG2, pref-1, FA1, SCP1, DlkI
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13386
HGNC: HGNC:2907
Homologene: 2846
Slc9a1
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 1
Synonyms: antiporter, Apnh, Nhe-1, Nhe1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20544
Homologene: 20660
Serpind1
Name: serine (or cysteine) peptidase inhibitor, clade D, member 1
Synonyms: HCII, HC II, Hcf2, heparin cofactor II
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15160
HGNC: HGNC:4838
Homologene: 36018
Zyx
Name: zyxin
Synonyms: R75157
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22793
Homologene: 31164
Bhmt
Name: betaine-homocysteine methyltransferase
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12116
HGNC: HGNC:1047
Homologene: 1295
Foxp2
Name: forkhead box P2
Synonyms: D0Kist7, 2810043D05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 114142
Homologene: 134404
Ndst3
Name: N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Synonyms: 4930511P15Rik, 4921531K01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 83398
HGNC: HGNC:7682
Homologene: 3513
Rap1gap2
Name: RAP1 GTPase activating protein 2
Synonyms: Garnl4, LOC380710
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380711
Homologene: 56695
Nos3
Name: nitric oxide synthase 3, endothelial cell
Synonyms: Nos-3, ecNOS, eNOS, 2310065A03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18127
HGNC: HGNC:7876
Homologene: 504
Prkag3
Name: protein kinase, AMP-activated, gamma 3 non-catalytic subunit
Synonyms: AMPKg3S, AMPKg3, AMPKg3L
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241113
HGNC: HGNC:9387
Homologene: 23006
Acad10
Name: acyl-Coenzyme A dehydrogenase family, member 10
Synonyms: 2410021P16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71985
Homologene: 49825
Pkd1l3
Name: polycystic kidney disease 1 like 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244646
Homologene: 14627
Vmn2r61
Name: vomeronasal 2, receptor 61
Synonyms: EG637873, Gprc2a-rs2, Casr-rs2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 637873
Homologene: 129683
Stard9
Name: StAR related lipid transfer domain containing 9
Synonyms: N-3 kinesin, Kif16a, E230025N21Rik, 4831403C07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 668880
Homologene: 130712
Nrp1
Name: neuropilin 1
Synonyms: Npn1, NPN-1, Neuropilin-1, NP-1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18186
HGNC: HGNC:8004
Homologene: 2876
Tigd2
Name: tigger transposable element derived 2
Synonyms: 3632410O17Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68140
Homologene: 129603
Pls1
Name: plastin 1 (I-isoform)
Synonyms: I-fimbrin
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102502
HGNC: HGNC:9090
Homologene: 68270
Stpg2
Name: sperm tail PG rich repeat containing 2
Synonyms: B930007M17Rik, LOC381476
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 381476
Homologene: 52167
Grin2b
Name: glutamate receptor, ionotropic, NMDA2B (epsilon 2)
Synonyms: GluRepsilon2, Nmdar2b, NR2B, NMDAR2B, GluN2B
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14812
HGNC: HGNC:4586
Homologene: 646
Abcc6
Name: ATP-binding cassette, sub-family C member 6
Synonyms: DCC, Dyscalc1, Mrp6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27421
HGNC: HGNC:57
Homologene: 55559
L3mbtl1
Name: L3MBTL1 histone methyl-lysine binding protein
Synonyms: L3MBTL1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241764
Homologene: 41846
Vars2
Name: valyl-tRNA synthetase 2, mitochondrial
Synonyms: 1190004I24Rik, Vars2l
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68915
Homologene: 57502
Myh4
Name: myosin, heavy polypeptide 4, skeletal muscle
Synonyms: MM, Minimsc, Myhsf, Minmus, MYH-2B, MyHC-IIb, MHC2B
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17884
HGNC: HGNC:7574
Homologene: 123880
Mybpc2
Name: myosin binding protein C, fast-type
Synonyms: Fast-type C-protein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233199
HGNC: HGNC:7550
Homologene: 3331
Manea
Name: mannosidase, endo-alpha
Synonyms: 4932703L02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242362
Homologene: 11636
Vil1
Name: villin 1
Synonyms: Villin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22349
Homologene: 5169
Pla2r1
Name: phospholipase A2 receptor 1
Synonyms: PLA2-I receptor, Pla2g1br, M-type receptor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18779
HGNC: HGNC:9042
Homologene: 32016
Cd96
Name: CD96 antigen
Synonyms: 1700109I12Rik, Tactile
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 84544
Homologene: 68489
Slc14a2
Name: solute carrier family 14 (urea transporter), member 2
Synonyms: UT-A3, UT-A5
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 27411
VEGA: 18
Homologene: 5183
Grid2
Name: glutamate receptor, ionotropic, delta 2
Synonyms: B230104L07Rik, GluRdelta2, tpr
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14804
HGNC: HGNC:4576
Homologene: 74399
Capn5
Name: calpain 5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12337
HGNC: HGNC:1482
Homologene: 31212
Or5af2
Name: olfactory receptor family 5 subfamily AC member 20
Synonyms: Olfr313, GA_x6K02T2NKPP-590035-589109, MOR222-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258529
Homologene: 77375
Hexb
Name: hexosaminidase B
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15212
VEGA: 13
HGNC: HGNC:4879
Homologene: 437
Myrf
Name: myelin regulatory factor
Synonyms: LOC225908, LOC386531, Gm98
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225908
HGNC: HGNC:1181
Homologene: 32167
Pde8b
Name: phosphodiesterase 8B
Synonyms: B230331L10Rik, C030047E14Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218461
HGNC: HGNC:8794
Homologene: 2758
Rhag
Name: Rhesus blood group-associated A glycoprotein
Synonyms: CD241, Rh50, Rh50A
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19743
Homologene: 68045
Prss56
Name: serine protease 56
Synonyms: Prss56, 1700027L20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69453
Homologene: 79885
Zfp760
Name: zinc finger protein 760
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240034
VEGA: 17
Or5p56
Name: olfactory receptor family 5 subfamily P member 56
Synonyms: MOR204-1, GA_x6K02T2PBJ9-10319672-10320604, Olfr477
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258928
Homologene: 27246
Vmn2r-ps158
Name: vomeronasal 2, receptor, pseudogene 158
Synonyms: Vmn2r126, Gm9268
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 668612
Homologene: 104832
Erich3
Name: glutamate rich 3
Synonyms: 5031409G23Rik, 4922501L14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 209601
Homologene: 27877
Or51aa2
Name: olfactory receptor family 51 subfamily AA member 2
Synonyms: GA_x6K02T2PBJ9-6251685-6250741, Olfr612, MOR15-3, EG545985
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 545985
Homologene: 79675
Capn15
Name: calpain 15
Synonyms: Solh
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 50817
Homologene: 45782
Scgb2b3
Name: secretoglobin, family 2B, member 3
Synonyms: Gm4362, Abpbg3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043326
Homologene: 83171
Pcdhga1
Name: protocadherin gamma subfamily A, 1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93709
HGNC: HGNC:8696
Homologene: 56824
Krtap5-24
Name: keratin associated protein 5-24
Synonyms: Gm40460
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 105244938
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 74,426,732 bp
  • A to G, chromosome 1 at 74,744,735 bp
  • A to G, chromosome 1 at 87,183,539 bp
  • A to T, chromosome 2 at 60,522,899 bp
  • A to T, chromosome 2 at 120,693,808 bp
  • A to G, chromosome 2 at 130,581,178 bp
  • A to G, chromosome 2 at 162,948,231 bp
  • A to G, chromosome 2 at 173,157,067 bp
  • G to A, chromosome 3 at 93,564,295 bp
  • A to G, chromosome 3 at 95,346,765 bp
  • G to T, chromosome 3 at 123,557,060 bp
  • A to G, chromosome 3 at 139,218,337 bp
  • G to T, chromosome 3 at 154,733,500 bp
  • A to T, chromosome 4 at 11,201,348 bp
  • A to T, chromosome 4 at 26,327,986 bp
  • C to A, chromosome 4 at 62,191,999 bp
  • A to G, chromosome 4 at 133,412,269 bp
  • A to T, chromosome 5 at 24,381,717 bp
  • T to C, chromosome 5 at 121,639,255 bp
  • C to T, chromosome 6 at 15,437,882 bp
  • G to T, chromosome 6 at 35,201,999 bp
  • A to T, chromosome 6 at 42,350,474 bp
  • G to A, chromosome 6 at 59,211,579 bp
  • A to G, chromosome 6 at 64,076,941 bp
  • A to G, chromosome 6 at 100,232,259 bp
  • T to G, chromosome 6 at 124,999,251 bp
  • C to T, chromosome 6 at 135,772,396 bp
  • T to A, chromosome 7 at 31,360,248 bp
  • C to G, chromosome 7 at 42,266,781 bp
  • T to G, chromosome 7 at 43,048,023 bp
  • A to G, chromosome 7 at 44,506,147 bp
  • A to G, chromosome 7 at 45,999,121 bp
  • A to G, chromosome 7 at 98,124,024 bp
  • T to C, chromosome 7 at 103,539,156 bp
  • G to A, chromosome 7 at 107,990,475 bp
  • A to G, chromosome 7 at 131,104,867 bp
  • ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,713 bp
  • T to A, chromosome 8 at 12,997,268 bp
  • A to T, chromosome 8 at 70,290,124 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • G to A, chromosome 8 at 128,431,987 bp
  • T to A, chromosome 9 at 95,787,087 bp
  • T to C, chromosome 9 at 106,659,136 bp
  • T to C, chromosome 10 at 45,158,524 bp
  • T to A, chromosome 11 at 58,817,060 bp
  • T to A, chromosome 11 at 67,256,395 bp
  • T to C, chromosome 11 at 74,435,722 bp
  • C to T, chromosome 11 at 101,106,390 bp
  • G to A, chromosome 12 at 109,454,963 bp
  • C to T, chromosome 13 at 93,620,081 bp
  • T to C, chromosome 13 at 95,086,750 bp
  • C to T, chromosome 13 at 97,198,173 bp
  • A to T, chromosome 13 at 100,633,286 bp
  • TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC to TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC, chromosome 13 at 104,050,416 bp
  • G to A, chromosome 15 at 79,426,366 bp
  • A to G, chromosome 16 at 17,336,675 bp
  • T to G, chromosome 16 at 46,052,021 bp
  • A to G, chromosome 16 at 90,792,864 bp
  • T to C, chromosome 16 at 93,870,936 bp
  • A to G, chromosome 17 at 21,722,891 bp
  • T to C, chromosome 17 at 25,960,764 bp
  • A to T, chromosome 17 at 35,664,788 bp
  • G to A, chromosome 17 at 40,828,395 bp
  • T to A, chromosome 18 at 37,749,682 bp
  • T to A, chromosome 18 at 78,155,588 bp
  • A to G, chromosome 19 at 10,228,876 bp
  • A to T, chromosome 19 at 41,029,487 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7553 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045622-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.