Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7553Btlr/Mmmh
Stock Number:
045622-MU
Citation ID:
RRID:MMRRC_045622-MU
Other Names:
R7553 (G1)
Major Collection:

Strain Information

Dntt
Name: deoxynucleotidyltransferase, terminal
Synonyms: Tdt
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21673
VEGA: 19
HGNC: HGNC:2983
Homologene: 3014
Csnk1e
Name: casein kinase 1, epsilon
Synonyms: CKI epsilon, tau, KC1epsilon, CKIepsilon, CK1epsilon
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 27373
Homologene: 121695
Pck1
Name: phosphoenolpyruvate carboxykinase 1, cytosolic
Synonyms: Pck-1, PEPCK
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18534
HGNC: HGNC:8724
Homologene: 1944
Avp
Name: arginine vasopressin
Synonyms: Vsp, Vp
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11998
HGNC: HGNC:894
Homologene: 417
Morc3
Name: microrchidia 3
Synonyms: 1110051N18Rik, D16Jhu32e, 1110051N18Rik, Zcwcc3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 338467
Homologene: 32257
Prep
Name: prolyl endopeptidase
Synonyms: prolyl oligopeptidase, D10Wsu136e, Pop
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19072
VEGA: 10
HGNC: HGNC:9358
Homologene: 2042
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 74,426,732 bp
  • A to G, chromosome 1 at 74,744,735 bp
  • A to G, chromosome 1 at 87,183,539 bp
  • A to T, chromosome 2 at 60,522,899 bp
  • A to T, chromosome 2 at 120,693,808 bp
  • A to G, chromosome 2 at 130,581,178 bp
  • A to G, chromosome 2 at 162,948,231 bp
  • A to G, chromosome 2 at 173,157,067 bp
  • G to A, chromosome 3 at 93,564,295 bp
  • A to G, chromosome 3 at 95,346,765 bp
  • G to T, chromosome 3 at 123,557,060 bp
  • A to G, chromosome 3 at 139,218,337 bp
  • G to T, chromosome 3 at 154,733,500 bp
  • A to T, chromosome 4 at 11,201,348 bp
  • A to T, chromosome 4 at 26,327,986 bp
  • C to A, chromosome 4 at 62,191,999 bp
  • A to G, chromosome 4 at 133,412,269 bp
  • A to T, chromosome 5 at 24,381,717 bp
  • T to C, chromosome 5 at 121,639,255 bp
  • C to T, chromosome 6 at 15,437,882 bp
  • G to T, chromosome 6 at 35,201,999 bp
  • A to T, chromosome 6 at 42,350,474 bp
  • G to A, chromosome 6 at 59,211,579 bp
  • A to G, chromosome 6 at 64,076,941 bp
  • A to G, chromosome 6 at 100,232,259 bp
  • T to G, chromosome 6 at 124,999,251 bp
  • C to T, chromosome 6 at 135,772,396 bp
  • T to A, chromosome 7 at 31,360,248 bp
  • C to G, chromosome 7 at 42,266,781 bp
  • T to G, chromosome 7 at 43,048,023 bp
  • A to G, chromosome 7 at 44,506,147 bp
  • A to G, chromosome 7 at 45,999,121 bp
  • A to G, chromosome 7 at 98,124,024 bp
  • T to C, chromosome 7 at 103,539,156 bp
  • G to A, chromosome 7 at 107,990,475 bp
  • A to G, chromosome 7 at 131,104,867 bp
  • ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,713 bp
  • T to A, chromosome 8 at 12,997,268 bp
  • A to T, chromosome 8 at 70,290,124 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • G to A, chromosome 8 at 128,431,987 bp
  • T to A, chromosome 9 at 95,787,087 bp
  • T to C, chromosome 9 at 106,659,136 bp
  • T to C, chromosome 10 at 45,158,524 bp
  • T to A, chromosome 11 at 58,817,060 bp
  • T to A, chromosome 11 at 67,256,395 bp
  • T to C, chromosome 11 at 74,435,722 bp
  • C to T, chromosome 11 at 101,106,390 bp
  • G to A, chromosome 12 at 109,454,963 bp
  • C to T, chromosome 13 at 93,620,081 bp
  • T to C, chromosome 13 at 95,086,750 bp
  • C to T, chromosome 13 at 97,198,173 bp
  • A to T, chromosome 13 at 100,633,286 bp
  • TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC to TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC, chromosome 13 at 104,050,416 bp
  • G to A, chromosome 15 at 79,426,366 bp
  • A to G, chromosome 16 at 17,336,675 bp
  • T to G, chromosome 16 at 46,052,021 bp
  • A to G, chromosome 16 at 90,792,864 bp
  • T to C, chromosome 16 at 93,870,936 bp
  • A to G, chromosome 17 at 21,722,891 bp
  • T to C, chromosome 17 at 25,960,764 bp
  • A to T, chromosome 17 at 35,664,788 bp
  • G to A, chromosome 17 at 40,828,395 bp
  • T to A, chromosome 18 at 37,749,682 bp
  • T to A, chromosome 18 at 78,155,588 bp
  • A to G, chromosome 19 at 10,228,876 bp
  • A to T, chromosome 19 at 41,029,487 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7553 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045622-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.