Strain Name:
C57BL/6J-MtgxR7604Btlr/Mmmh
Stock Number:
045644-MU
Citation ID:
RRID:MMRRC_045644-MU
Other Names:
R7604 (G1)
Major Collection:

Strain Information

Sbf2
Name: SET binding factor 2
Synonyms: 4833411B01Rik, Mtmr13, B430219L04Rik, mMTMH1, SBF2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319934
HGNC: HGNC:2135
Homologene: 41810
Nrxn2
Name: neurexin II
Synonyms: neurexin II alpha, 6430591O13Rik, neurexin II beta
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18190
HGNC: HGNC:8009
Homologene: 86984
Epha7
Name: Eph receptor A7
Synonyms: Hek11, Ehk3, Cek11, MDK1, Mdk1, Ebk
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13841
HGNC: HGNC:3390
Homologene: 20935
Abce1
Name: ATP-binding cassette, sub-family E member 1
Synonyms: Oabp, RNS4l (Eye), Rnaseli
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 24015
HGNC: HGNC:69
Homologene: 2205
Ccdc88c
Name: coiled-coil domain containing 88C
Synonyms: Daple, 0610010D24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68339
VEGA: 12
Homologene: 18903
Kmt2e
Name: lysine (K)-specific methyltransferase 2E
Synonyms: Mll5, D230038D11Rik, 1810033J14Rik, 9530077A04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69188
Homologene: 18822
Mcm7
Name: minichromosome maintenance complex component 7
Synonyms: Mcmd7, mCDC47
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17220
HGNC: HGNC:6950
Homologene: 4323
Ahcyl2
Name: S-adenosylhomocysteine hydrolase-like 2
Synonyms: 4631427C17Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74340
Homologene: 69337
Cyp11b2
Name: cytochrome P450, family 11, subfamily b, polypeptide 2
Synonyms: aldosterone synthase, Cyp11b-2, steroid-11-beta-hydroxylase, Cyp11b
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13072
Homologene: 128035
Slc29a1
Name: solute carrier family 29 (nucleoside transporters), member 1
Synonyms: 1200014D21Rik, NBMPR-sensitive equilibrative nucleoside transporter, ENT1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 63959
Homologene: 37985
Ptpn3
Name: protein tyrosine phosphatase, non-receptor type 3
Synonyms: PTPCL, PTP-H1, 9530011I20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 545622
HGNC: HGNC:9655
Homologene: 74451
Gria4
Name: glutamate receptor, ionotropic, AMPA4 (alpha 4)
Synonyms: Glur-4, Gluralpha4, Glur4, spkw1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14802
HGNC: HGNC:4574
Homologene: 20227
Phf20l1
Name: PHD finger protein 20-like 1
Synonyms: CGI-72, E130113K22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239510
VEGA: 15
Homologene: 9341
Aff1
Name: AF4/FMR2 family, member 1
Synonyms: 9630032B01Rik, Rob, Mllt2h, Af4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17355
HGNC: HGNC:7135
Homologene: 4340
Bltp1
Name: bridge-like lipid transfer protein family member 1
Synonyms: FSA, 4932438A13Rik, Tweek
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229227
Homologene: 52105
Eftud2
Name: elongation factor Tu GTP binding domain containing 2
Synonyms: Snrp116, U5-116kD, 116kDa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20624
Homologene: 3133
Xpo7
Name: exportin 7
Synonyms: Ranbp16, 4930506C02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 65246
VEGA: 14
Homologene: 22857
Azin1
Name: antizyme inhibitor 1
Synonyms: 1700085L02Rik, Oazin, Oazi, ODC antizyme inhibitor
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 54375
Homologene: 22933
Ezh1
Name: enhancer of zeste 1 polycomb repressive complex 2 subunit
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14055
HGNC: HGNC:3526
Homologene: 20458
Dhx8
Name: DEAH-box helicase 8
Synonyms: Ddx8, mDEAH6, RNA helicase
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217207
HGNC: HGNC:2749
Homologene: 3628
Trio
Name: triple functional domain (PTPRF interacting)
Synonyms: Solo, 6720464I07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223435
VEGA: 15
Homologene: 20847
Hspd1
Name: heat shock protein 1 (chaperonin)
Synonyms: Hsp60
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15510
HGNC: HGNC:5261
Homologene: 1626
Epha6
Name: Eph receptor A6
Synonyms: m-ehk2, Hek12, Ehk2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13840
Homologene: 56396
Galnt14
Name: polypeptide N-acetylgalactosaminyltransferase 14
Synonyms: 0610033M06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71685
Homologene: 56997
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
E4f1
Name: E4F transcription factor 1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13560
VEGA: 17
HGNC: HGNC:3121
Homologene: 3259
Spint2
Name: serine protease inhibitor, Kunitz type 2
Synonyms: HAI-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20733
Homologene: 7955
Mta2
Name: metastasis-associated gene family, member 2
Synonyms: mmta2, Mta1l1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 23942
HGNC: HGNC:7411
Homologene: 3480
Peak1
Name: pseudopodium-enriched atypical kinase 1
Synonyms: NKF3 kinase family member, 1110049L02Rik, C230081A13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244895
Homologene: 18259
Mphosph9
Name: M-phase phosphoprotein 9
Synonyms: MPP9, 4930548D04Rik, 9630025B04Rik, MPP-9, B930097C17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269702
HGNC: HGNC:7215
Homologene: 11256
Gnao1
Name: guanine nucleotide binding protein, alpha O
Synonyms: Go alpha, alphaO, Galphao
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14681
HGNC: HGNC:4389
Homologene: 39203
Adamts13
Name: ADAM metallopeptidase with thrombospondin type 1 motif 13
Synonyms: LOC279028, vWF-CP mRNA for von Willebrand factor-cleaving
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 279028
HGNC: HGNC:1366
Homologene: 16372
Ndufs7
Name: NADH:ubiquinone oxidoreductase core subunit S7
Synonyms: 1010001M04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75406
HGNC: HGNC:7714
Homologene: 11535
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Dnah6
Name: dynein, axonemal, heavy chain 6
Synonyms: Dnahc6, A730004I20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330355
HGNC: HGNC:2951
Homologene: 15221
Dchs1
Name: dachsous cadherin related 1
Synonyms: 3110041P15Rik, C130033F22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233651
Homologene: 2771
Unc13b
Name: unc-13 homolog B
Synonyms: Unc13h2, Munc13-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22249
Homologene: 31376
Lama3
Name: laminin, alpha 3
Synonyms: [a]3B, nicein, 150kDa
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16774
HGNC: HGNC:6483
Homologene: 18279
Sdk2
Name: sidekick cell adhesion molecule 2
Synonyms: 4632412F08Rik, 5330435L01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237979
Homologene: 10406
Slc5a8
Name: solute carrier family 5 (iodide transporter), member 8
Synonyms: SMCT
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216225
VEGA: 10
Homologene: 64832
Sycp1
Name: synaptonemal complex protein 1
Synonyms: SCP1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20957
Homologene: 2389
Poteg
Name: POTE ankyrin domain family, member G
Synonyms: 4930456F22Rik, 4921537P18Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70952
Homologene: 134158
Mroh8
Name: maestro heat-like repeat family member 8
Synonyms: 4922505G16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 629499
Homologene: 51864
Kif6
Name: kinesin family member 6
Synonyms: D130004B10Rik, D130084M03Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 319991
Homologene: 35308
Lpcat3
Name: lysophosphatidylcholine acyltransferase 3
Synonyms: Mboat5, Grcc3f, Oact5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14792
Homologene: 14678
Grik3
Name: glutamate receptor, ionotropic, kainate 3
Synonyms: Glur7, Glur-7
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14807
HGNC: HGNC:4581
Homologene: 73901
Adam2
Name: a disintegrin and metallopeptidase domain 2
Synonyms: fertilin beta, Ph30-beta, Ftnb
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 11495
VEGA: 14
HGNC: HGNC:198
Homologene: 1127
Tpsg1
Name: tryptase gamma 1
Synonyms: Prss31, TMT
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 26945
Homologene: 74994
Vmn2r79
Name: vomeronasal 2, receptor 79
Synonyms: EG621430
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 621430
Homologene: 115466
Proc
Name: protein C
Synonyms: PC, inactivator of coagulation factors Va, VIII
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 19123
VEGA: 18
HGNC: HGNC:9451
Homologene: 37288
Gde1
Name: glycerophosphodiester phosphodiesterase 1
Synonyms: MIR16, 1200003M13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56209
Homologene: 41149
Sipa1l2
Name: signal-induced proliferation-associated 1 like 2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244668
Homologene: 18956
4930503B20Rik
Name: RIKEN cDNA 4930503B20 gene
Type: Gene
Species: Mouse
Chromosome: 3
Homologene: 41344
Slc15a5
Name: solute carrier family 15, member 5
Synonyms: 9830102E05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 277898
Homologene: 65333
Actl7b
Name: actin-like 7b
Synonyms: ENSMUSG00000070980, t-actin 1, Tact1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11471
HGNC: HGNC:162
Homologene: 21330
Hivep3
Name: human immunodeficiency virus type I enhancer binding protein 3
Synonyms: Schnurri-3, E030045D18Rik, Shn3, 2900056N03Rik, Krc
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16656
Homologene: 7803
Selplg
Name: selectin, platelet (p-selectin) ligand
Synonyms: Psgl-1, Psgl1, CD162
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20345
Homologene: 2261
Lrrc63
Name: leucine rich repeat containing 63
Synonyms: 4921509B22Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70859
Homologene: 52823
Prr36
Name: proline rich 36
Synonyms: BC068157
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 73072
Homologene: 136398
Pbxip1
Name: pre B cell leukemia transcription factor interacting protein 1
Synonyms: 4732463H20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229534
Homologene: 10740
Or8k21
Name: olfactory receptor family 8 subfamily K member 21
Synonyms: GA_x6K02T2Q125-47793414-47792471, Olfr1053-ps1, MOR187-4, Olfr1053
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257974
Homologene: 74197
Garin2
Name: golgi associated RAB2 interactor 2
Synonyms: 4921509E07Rik, Fam71d, 4930516C23Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70897
Homologene: 49887
Bahd1
Name: bromo adjacent homology domain containing 1
Synonyms: LOC228536
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228536
Homologene: 8976
Anks1b
Name: ankyrin repeat and sterile alpha motif domain containing 1B
Synonyms: LOC380650, Gm10937, C030032C09Rik, E530015N03Rik, AIDA-1b
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 77531
Homologene: 51570
Ccdc90b
Name: coiled-coil domain containing 90B
Synonyms: 2310015N07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66365
Homologene: 23328
Zfp747l1
Name: zinc finger protein 747 like 1
Synonyms: 9130019O22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78921
Homologene: 118005
C1qbp
Name: complement component 1, q subcomponent binding protein
Synonyms: P32, HABP1, D11Wsu182e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12261
HGNC: HGNC:1243
Homologene: 31023
Gldn
Name: gliomedin
Synonyms: Crlg2, CRG-L2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235379
Homologene: 14529
Rnf5
Name: ring finger protein 5
Synonyms: 2410131O05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 54197
Homologene: 56004
Malrd1
Name: MAM and LDL receptor class A domain containing 1
Synonyms: Gm13318, Gm13364, Diet1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 102635496
Homologene: 136214
Cfap91
Name: cilia and flagella associated protein 91
Synonyms: Spata26, Maats1, 4932425I24Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 320214
Homologene: 33470
Gpr135
Name: G protein-coupled receptor 135
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238252
VEGA: 12
Homologene: 11211
C1rb
Name: complement component 1, r subcomponent B
Synonyms: Gm8551, mC1rB
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 667277
HGNC: HGNC:1246
Homologene: 1313
Gm32742
Name: predicted gene, 32742
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102635385
Homologene: 132734
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 55,080,337 bp
  • A to G, chromosome 2 at 15,925,192 bp
  • A to G, chromosome 2 at 27,005,206 bp
  • G to A, chromosome 2 at 86,314,900 bp
  • A to G, chromosome 2 at 118,916,310 bp
  • G to T, chromosome 2 at 157,269,564 bp
  • A to G, chromosome 3 at 36,949,843 bp
  • A to T, chromosome 3 at 89,445,595 bp
  • A to T, chromosome 3 at 102,913,433 bp
  • A to T, chromosome 3 at 146,650,660 bp
  • C to T, chromosome 4 at 28,871,937 bp
  • A to G, chromosome 4 at 43,170,102 bp
  • A to G, chromosome 4 at 43,256,776 bp
  • G to C, chromosome 4 at 56,740,693 bp
  • T to C, chromosome 4 at 57,240,845 bp
  • CGG to CG, chromosome 4 at 120,097,911 bp
  • C to A, chromosome 4 at 125,623,635 bp
  • C to T, chromosome 5 at 23,501,765 bp
  • G to A, chromosome 5 at 103,847,809 bp
  • GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT, chromosome 5 at 113,819,695 bp
  • C to T, chromosome 5 at 124,316,117 bp
  • C to T, chromosome 5 at 138,169,724 bp
  • T to C, chromosome 6 at 29,768,556 bp
  • T to C, chromosome 6 at 73,092,168 bp
  • A to G, chromosome 6 at 124,580,484 bp
  • A to G, chromosome 6 at 124,702,530 bp
  • A to T, chromosome 6 at 138,079,786 bp
  • T to C, chromosome 7 at 29,258,519 bp
  • A to G, chromosome 7 at 87,003,384 bp
  • A to G, chromosome 7 at 92,578,530 bp
  • A to G, chromosome 7 at 105,765,982 bp
  • T to A, chromosome 7 at 110,378,067 bp
  • A to T, chromosome 7 at 118,705,536 bp
  • T to C, chromosome 7 at 127,386,535 bp
  • A to T, chromosome 7 at 141,809,709 bp
  • G to A, chromosome 8 at 4,214,836 bp
  • T to A, chromosome 8 at 27,458,655 bp
  • G to A, chromosome 8 at 79,699,374 bp
  • T to G, chromosome 8 at 93,944,344 bp
  • A to T, chromosome 8 at 125,419,272 bp
  • A to G, chromosome 9 at 4,464,315 bp
  • G to T, chromosome 9 at 51,156,762 bp
  • G to A, chromosome 9 at 54,338,593 bp
  • A to T, chromosome 9 at 56,241,207 bp
  • G to T, chromosome 10 at 80,253,697 bp
  • G to T, chromosome 10 at 88,904,960 bp
  • A to G, chromosome 10 at 90,260,846 bp
  • A to G, chromosome 11 at 70,978,772 bp
  • A to G, chromosome 11 at 101,217,029 bp
  • T to C, chromosome 11 at 101,764,797 bp
  • T to C, chromosome 11 at 102,848,012 bp
  • C to T, chromosome 11 at 113,829,969 bp
  • A to T, chromosome 12 at 72,069,867 bp
  • C to A, chromosome 12 at 78,715,014 bp
  • A to T, chromosome 12 at 100,930,547 bp
  • T to C, chromosome 14 at 66,056,541 bp
  • T to A, chromosome 14 at 70,671,670 bp
  • C to A, chromosome 14 at 75,084,969 bp
  • A to T, chromosome 15 at 27,736,445 bp
  • A to C, chromosome 15 at 38,491,634 bp
  • A to G, chromosome 15 at 66,604,084 bp
  • A to T, chromosome 15 at 74,853,750 bp
  • C to A, chromosome 16 at 38,298,236 bp
  • T to A, chromosome 16 at 60,205,772 bp
  • G to T, chromosome 17 at 24,455,233 bp
  • G to T, chromosome 17 at 25,373,210 bp
  • T to C, chromosome 17 at 30,813,095 bp
  • C to A, chromosome 17 at 34,601,664 bp
  • C to A, chromosome 17 at 45,592,324 bp
  • T to C, chromosome 17 at 49,671,101 bp
  • T to A, chromosome 17 at 73,504,921 bp
  • C to T, chromosome 18 at 12,500,493 bp
  • G to A, chromosome 18 at 32,134,778 bp
  • T to C, chromosome 19 at 6,531,961 bp
  • T to A, chromosome 19 at 8,945,836 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7604 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045644-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.