Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7604Btlr/Mmmh
Stock Number:
045644-MU
Citation ID:
RRID:MMRRC_045644-MU
Other Names:
R7604 (G1)
Major Collection:

Strain Information

Sbf2
Name: SET binding factor 2
Synonyms: SBF2, 4833411B01Rik, mMTMH1, B430219L04Rik, Mtmr13
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319934
HGNC: HGNC:2135
Homologene: 41810
Nrxn2
Name: neurexin II
Synonyms: neurexin II beta, neurexin II alpha, 6430591O13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18190
HGNC: HGNC:8009
Homologene: 86984
Epha7
Name: Eph receptor A7
Synonyms: MDK1, Ebk, Cek11, Ehk3, Hek11, Mdk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13841
HGNC: HGNC:3390
Homologene: 20935
Abce1
Name: ATP-binding cassette, sub-family E member 1
Synonyms: RNS4l (Eye), Oabp, Rnaseli
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 24015
HGNC: HGNC:69
Homologene: 2205
Ccdc88c
Name: coiled-coil domain containing 88C
Synonyms: Daple, 0610010D24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68339
VEGA: 12
Homologene: 18903
Kmt2e
Name: lysine (K)-specific methyltransferase 2E
Synonyms: 1810033J14Rik, D230038D11Rik, 9530077A04Rik, Mll5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69188
Homologene: 18822
Mcm7
Name: minichromosome maintenance complex component 7
Synonyms: mCDC47, Mcmd7
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17220
HGNC: HGNC:6950
Homologene: 4323
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 55,080,337 bp
  • A to G, chromosome 2 at 15,925,192 bp
  • A to G, chromosome 2 at 27,005,206 bp
  • G to A, chromosome 2 at 86,314,900 bp
  • A to G, chromosome 2 at 118,916,310 bp
  • G to T, chromosome 2 at 157,269,564 bp
  • A to G, chromosome 3 at 36,949,843 bp
  • A to T, chromosome 3 at 89,445,595 bp
  • A to T, chromosome 3 at 102,913,433 bp
  • A to T, chromosome 3 at 146,650,660 bp
  • C to T, chromosome 4 at 28,871,937 bp
  • A to G, chromosome 4 at 43,170,102 bp
  • A to G, chromosome 4 at 43,256,776 bp
  • G to C, chromosome 4 at 56,740,693 bp
  • T to C, chromosome 4 at 57,240,845 bp
  • CGG to CG, chromosome 4 at 120,097,911 bp
  • C to A, chromosome 4 at 125,623,635 bp
  • C to T, chromosome 5 at 23,501,765 bp
  • G to A, chromosome 5 at 103,847,809 bp
  • GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT, chromosome 5 at 113,819,695 bp
  • C to T, chromosome 5 at 124,316,117 bp
  • C to T, chromosome 5 at 138,169,724 bp
  • T to C, chromosome 6 at 29,768,556 bp
  • T to C, chromosome 6 at 73,092,168 bp
  • A to G, chromosome 6 at 124,580,484 bp
  • A to G, chromosome 6 at 124,702,530 bp
  • A to T, chromosome 6 at 138,079,786 bp
  • T to C, chromosome 7 at 29,258,519 bp
  • A to G, chromosome 7 at 87,003,384 bp
  • A to G, chromosome 7 at 92,578,530 bp
  • A to G, chromosome 7 at 105,765,982 bp
  • T to A, chromosome 7 at 110,378,067 bp
  • A to T, chromosome 7 at 118,705,536 bp
  • T to C, chromosome 7 at 127,386,535 bp
  • A to T, chromosome 7 at 141,809,709 bp
  • G to A, chromosome 8 at 4,214,836 bp
  • T to A, chromosome 8 at 27,458,655 bp
  • G to A, chromosome 8 at 79,699,374 bp
  • T to G, chromosome 8 at 93,944,344 bp
  • A to T, chromosome 8 at 125,419,272 bp
  • A to G, chromosome 9 at 4,464,315 bp
  • G to T, chromosome 9 at 51,156,762 bp
  • G to A, chromosome 9 at 54,338,593 bp
  • A to T, chromosome 9 at 56,241,207 bp
  • G to T, chromosome 10 at 80,253,697 bp
  • G to T, chromosome 10 at 88,904,960 bp
  • A to G, chromosome 10 at 90,260,846 bp
  • A to G, chromosome 11 at 70,978,772 bp
  • A to G, chromosome 11 at 101,217,029 bp
  • T to C, chromosome 11 at 101,764,797 bp
  • T to C, chromosome 11 at 102,848,012 bp
  • C to T, chromosome 11 at 113,829,969 bp
  • A to T, chromosome 12 at 72,069,867 bp
  • C to A, chromosome 12 at 78,715,014 bp
  • A to T, chromosome 12 at 100,930,547 bp
  • T to C, chromosome 14 at 66,056,541 bp
  • T to A, chromosome 14 at 70,671,670 bp
  • C to A, chromosome 14 at 75,084,969 bp
  • A to T, chromosome 15 at 27,736,445 bp
  • A to C, chromosome 15 at 38,491,634 bp
  • A to G, chromosome 15 at 66,604,084 bp
  • A to T, chromosome 15 at 74,853,750 bp
  • C to A, chromosome 16 at 38,298,236 bp
  • T to A, chromosome 16 at 60,205,772 bp
  • G to T, chromosome 17 at 24,455,233 bp
  • G to T, chromosome 17 at 25,373,210 bp
  • T to C, chromosome 17 at 30,813,095 bp
  • C to A, chromosome 17 at 34,601,664 bp
  • C to A, chromosome 17 at 45,592,324 bp
  • T to C, chromosome 17 at 49,671,101 bp
  • T to A, chromosome 17 at 73,504,921 bp
  • C to T, chromosome 18 at 12,500,493 bp
  • G to A, chromosome 18 at 32,134,778 bp
  • T to C, chromosome 19 at 6,531,961 bp
  • T to A, chromosome 19 at 8,945,836 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7604 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045644-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.