Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7578Btlr/Mmmh
Stock Number:
045663-MU
Citation ID:
RRID:MMRRC_045663-MU
Other Names:
R7578 (G1)
Major Collection:

Strain Information

Rai14
Name: retinoic acid induced 14
Synonyms: 1700020L11Rik, Ankycorbin, Norpeg, 1700008J19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75646
VEGA: 15
Homologene: 9199
Yes1
Name: YES proto-oncogene 1, Src family tyrosine kinase
Synonyms: Yes
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22612
Homologene: 55900
Smg7
Name: SMG7 nonsense mediated mRNA decay factor
Synonyms: 9430023P16Rik, Smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226517
Homologene: 32235
Ptpn23
Name: protein tyrosine phosphatase, non-receptor type 23
Synonyms: PTP-TD14
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 104831
Homologene: 135706
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: D7H15F32S1, D15F32S1h, D7H15F37S1, rjs, jdf2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Akap9
Name: A kinase anchor protein 9
Synonyms: AKAP450, 5730481H23Rik, G1-448-15, repro12, mei2-5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100986
HGNC: HGNC:379
Homologene: 134583
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 20,347,361 bp
  • A to G, chromosome 1 at 56,871,784 bp
  • T to C, chromosome 1 at 79,436,895 bp
  • T to G, chromosome 1 at 151,921,090 bp
  • T to A, chromosome 1 at 152,845,430 bp
  • G to T, chromosome 1 at 169,504,528 bp
  • T to A, chromosome 1 at 174,050,700 bp
  • T to A, chromosome 1 at 188,549,913 bp
  • A to G, chromosome 2 at 68,118,552 bp
  • T to A, chromosome 2 at 83,747,875 bp
  • T to C, chromosome 2 at 162,932,862 bp
  • A to G, chromosome 3 at 19,989,098 bp
  • G to T, chromosome 3 at 85,665,898 bp
  • A to G, chromosome 3 at 89,176,500 bp
  • A to G, chromosome 3 at 89,344,192 bp
  • A to G, chromosome 3 at 105,459,617 bp
  • T to G, chromosome 4 at 117,760,719 bp
  • TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT to TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT, chromosome 4 at 156,218,068 bp
  • C to G, chromosome 5 at 3,968,745 bp
  • A to G, chromosome 5 at 31,172,997 bp
  • G to A, chromosome 5 at 32,645,086 bp
  • A to T, chromosome 5 at 96,684,437 bp
  • G to A, chromosome 5 at 105,236,149 bp
  • A to T, chromosome 5 at 120,802,179 bp
  • A to T, chromosome 5 at 146,183,533 bp
  • A to G, chromosome 6 at 71,908,707 bp
  • T to C, chromosome 6 at 92,411,290 bp
  • C to T, chromosome 7 at 3,665,383 bp
  • A to C, chromosome 7 at 7,231,442 bp
  • A to G, chromosome 7 at 56,134,800 bp
  • T to A, chromosome 7 at 67,226,289 bp
  • A to T, chromosome 7 at 86,954,344 bp
  • CGGC to CGGCGGCGGGGGC, chromosome 7 at 97,579,932 bp
  • T to C, chromosome 7 at 100,293,914 bp
  • T to C, chromosome 7 at 104,058,897 bp
  • T to A, chromosome 7 at 128,112,258 bp
  • T to C, chromosome 7 at 135,700,915 bp
  • C to T, chromosome 7 at 137,313,532 bp
  • T to C, chromosome 8 at 40,680,255 bp
  • A to G, chromosome 8 at 69,103,476 bp
  • G to A, chromosome 8 at 72,464,258 bp
  • G to T, chromosome 9 at 34,939,112 bp
  • A to G, chromosome 9 at 50,789,535 bp
  • T to A, chromosome 9 at 110,387,608 bp
  • T to A, chromosome 10 at 19,631,624 bp
  • G to A, chromosome 10 at 60,407,407 bp
  • G to A, chromosome 10 at 90,049,927 bp
  • A to T, chromosome 10 at 117,740,579 bp
  • T to C, chromosome 10 at 129,409,675 bp
  • A to T, chromosome 11 at 63,094,660 bp
  • A to G, chromosome 11 at 98,982,475 bp
  • A to G, chromosome 11 at 103,635,006 bp
  • T to C, chromosome 12 at 78,715,501 bp
  • T to A, chromosome 12 at 101,588,285 bp
  • C to T, chromosome 13 at 45,567,358 bp
  • T to C, chromosome 14 at 51,895,416 bp
  • T to A, chromosome 14 at 57,549,871 bp
  • T to C, chromosome 14 at 65,648,174 bp
  • G to T, chromosome 15 at 10,574,828 bp
  • C to T, chromosome 15 at 10,593,103 bp
  • C to T, chromosome 15 at 27,854,939 bp
  • T to C, chromosome 15 at 78,540,517 bp
  • A to G, chromosome 16 at 57,513,282 bp
  • A to C, chromosome 16 at 94,499,069 bp
  • A to G, chromosome 17 at 3,532,999 bp
  • T to C, chromosome 17 at 20,624,031 bp
  • A to T, chromosome 18 at 7,211,593 bp
  • A to G, chromosome 18 at 44,168,146 bp
  • A to C, chromosome 19 at 20,618,002 bp
  • T to C, chromosome 19 at 39,510,956 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7578 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045663-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.