Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7578Btlr/Mmmh
Stock Number:
045663-MU
Citation ID:
RRID:MMRRC_045663-MU
Other Names:
R7578 (G1)
Major Collection:

Strain Information

Rai14
Name: retinoic acid induced 14
Synonyms: 1700020L11Rik, Ankycorbin, Norpeg, 1700008J19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75646
VEGA: 15
Homologene: 9199
Yes1
Name: YES proto-oncogene 1, Src family tyrosine kinase
Synonyms: Yes
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22612
Homologene: 55900
Smg7
Name: SMG7 nonsense mediated mRNA decay factor
Synonyms: 9430023P16Rik, Smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226517
Homologene: 32235
Ptpn23
Name: protein tyrosine phosphatase, non-receptor type 23
Synonyms: PTP-TD14
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 104831
Homologene: 135706
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: D7H15F32S1, D15F32S1h, rjs, D7H15F37S1, jdf2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Akap9
Name: A kinase anchor protein 9
Synonyms: AKAP450, 5730481H23Rik, G1-448-15, repro12, mei2-5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100986
HGNC: HGNC:379
Homologene: 134583
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Mki67
Name: antigen identified by monoclonal antibody Ki 67
Synonyms: Ki-67, D630048A14Rik, Ki67
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17345
HGNC: HGNC:7107
Homologene: 1814
Vps26c
Name: VPS26 endosomal protein sorting factor C
Synonyms: Dcra, Down syndrome critical region gene 3, Dscr3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13185
HGNC: HGNC:3044
Homologene: 4415
Ptcd3
Name: pentatricopeptide repeat domain 3
Synonyms: 2610034F17Rik, 2810422B04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 69956
Homologene: 41211
Nuf2
Name: NUF2, NDC80 kinetochore complex component
Synonyms: 2410003C07Rik, Nuf2R, Cdca1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66977
Homologene: 40205
Trio
Name: triple functional domain (PTPRF interacting)
Synonyms: 6720464I07Rik, Solo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223435
VEGA: 15
Homologene: 20847
Slc39a2
Name: solute carrier family 39 (zinc transporter), member 2
Synonyms: zip2, F730005G13Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 214922
Homologene: 40957
Atp6v1b2
Name: ATPase, H+ transporting, lysosomal V1 subunit B2
Synonyms: HO57, Atp6b2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11966
HGNC: HGNC:854
Homologene: 1279
Satb2
Name: special AT-rich sequence binding protein 2
Synonyms: BAP002
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 212712
Homologene: 32249
Ebf3
Name: early B cell factor 3
Synonyms: O/E-2, Olf-1/EBF-like 2, 3110018A08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13593
Homologene: 56472
Il22ra2
Name: interleukin 22 receptor, alpha 2
Synonyms: Il-22bp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237310
Homologene: 18657
Kirrel3
Name: kirre like nephrin family adhesion molecule 3
Synonyms: Neph2, 1500010O20Rik, 2900036G11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67703
Homologene: 57050
Srsf6
Name: serine and arginine-rich splicing factor 6
Synonyms: 1210001E11Rik, Sfrs6
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67996
Homologene: 110783
Slc35e3
Name: solute carrier family 35, member E3
Synonyms: 9330166G04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215436
VEGA: 10
Homologene: 41279
Gtf3c2
Name: general transcription factor IIIC, polypeptide 2, beta
Synonyms: 2610510G03Rik, TFIIIC-BETA, TFIIIC110, 1300004C11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71752
HGNC: HGNC:4665
Homologene: 37490
Aldh1a1
Name: aldehyde dehydrogenase family 1, subfamily A1
Synonyms: ALDH1, E1, Ahd-2, Ahd2, Raldh1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 11668
HGNC: HGNC:402
Homologene: 110441
Cdh23
Name: cadherin related 23 (otocadherin)
Synonyms: 4930542A03Rik, USH1D, mdfw, ahl, nmf252, bob, nmf112, nmf181, sals
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22295
Homologene: 11142
Adam15
Name: ADAM metallopeptidase domain 15
Synonyms: metargidin, MDC15
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11490
HGNC: HGNC:193
Homologene: 2829
Fhip1a
Name: FHF complex subunit HOOK interacting protein 1A
Synonyms: 9930021J17Rik, Fam160a1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229488
Homologene: 85149
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: tigmin, FPC
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241035
HGNC: HGNC:9016
Homologene: 16336
Ush2a
Name: usherin
Synonyms: MUSH2A, A930011D15Rik, LOC381317, LOC269160, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Or10aa3
Name: olfactory receptor family 10 subfamily AA member 3
Synonyms: GA_x6K02T2P20D-21124681-21123743, MOR123-2, Olfr432
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258711
Homologene: 81532
Lyzl6
Name: lysozyme-like 6
Synonyms: 1700023H08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69444
Homologene: 10709
Lysmd4
Name: LysM, putative peptidoglycan-binding, domain containing 4
Synonyms: 4930506D23Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75099
Homologene: 45123
Vmn2r78
Name: vomeronasal 2, receptor 78
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 637896
Homologene: 115466
Klf17
Name: Kruppel-like transcription factor 17
Synonyms: D4Ertd561e, 7420700M05Rik, Zfp393
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75753
Homologene: 12621
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: bl, E130113P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
Perm1
Name: PPARGC1 and ESRR induced regulator, muscle 1
Synonyms: 2310042D19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74183
Homologene: 135954
Odad2
Name: outer dynein arm docking complex subunit 2
Synonyms: 4930463I21Rik, Armc4, b2b227.1Clo, b2b643Clo
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 74934
VEGA: 18
Homologene: 9992
Cyp2c39
Name: cytochrome P450, family 2, subfamily c, polypeptide 39
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13098
Homologene: 117948
Nuggc
Name: nuclear GTPase, germinal center associated
Synonyms: LOC239151, SLIP-GC, Gm600
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100503545
Homologene: 72641
Prickle2
Name: prickle planar cell polarity protein 2
Synonyms: 6720451F06Rik, 6230400G14Rik, mpk2, Pk2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243548
Homologene: 17889
Atxn1
Name: ataxin 1
Synonyms: Atx1, Sca1, 2900016G23Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20238
VEGA: 13
Homologene: 281
Itgav
Name: integrin alpha V
Synonyms: vitronectin receptor alpha polypeptide (VNRA), CD51, alphav-integrin, 1110004F14Rik, 2610028E01Rik, D430040G12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16410
HGNC: HGNC:6150
Homologene: 20510
Adam24
Name: ADAM metallopeptidase domain 24
Synonyms: Dtgn5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13526
HGNC: HGNC:203
Homologene: 137232
Scg2
Name: secretogranin II
Synonyms: SgII, Chgc
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20254
Homologene: 2591
Fpr-rs3
Name: formyl peptide receptor, related sequence 3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14290
HGNC: HGNC:3827
Homologene: 130087
Tekt3
Name: tektin 3
Synonyms: 4933407G07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71062
Homologene: 12896
Gbp10
Name: guanylate-binding protein 10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 626578
Homologene: 128731
Sstr3
Name: somatostatin receptor 3
Synonyms: sst3, Smstr-3, Smstr3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20607
VEGA: 15
Homologene: 20285
Cherp
Name: calcium homeostasis endoplasmic reticulum protein
Synonyms: 5730408I11Rik, SCAF6, DAN16, D8Wsu96e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 27967
Homologene: 4656
B3galt1
Name: UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1
Synonyms: 6330417G03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26877
HGNC: HGNC:916
Homologene: 41362
Kcnd3
Name: potassium voltage-gated channel, Shal-related family, member 3
Synonyms: potassium channel Kv4.3M, potassium channel Kv4.3L, Kv4.3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56543
HGNC: HGNC:6239
Homologene: 21036
Oas1c
Name: 2'-5' oligoadenylate synthetase 1C
Synonyms: Oasl5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 114643
HGNC: HGNC:8086
Homologene: 110815
Catsperb
Name: cation channel sperm associated auxiliary subunit beta
Synonyms: 4932415G16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 271036
VEGA: 12
Homologene: 81904
4930516K23Rik
Name: RIKEN cDNA 4930516K23 gene
Type: Gene
Species: Mouse
Chromosome: 7
1700001J03Rik
Name: RIKEN cDNA 1700001J03 gene
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69282
Homologene: 86127
Garin2
Name: golgi associated RAB2 interactor 2
Synonyms: 4930516C23Rik, 4921509E07Rik, Fam71d
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70897
Homologene: 49887
P4ha3
Name: procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide III
Synonyms: D930031A02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320452
Homologene: 27943
Filip1l
Name: filamin A interacting protein 1-like
Synonyms: 4631422O05Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78749
Homologene: 37121
Anks1b
Name: ankyrin repeat and sterile alpha motif domain containing 1B
Synonyms: LOC380650, C030032C09Rik, E530015N03Rik, AIDA-1b, Gm10937
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 77531
Homologene: 51570
Cldn20
Name: claudin 20
Synonyms: EG621628
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 621628
VEGA: 17
HGNC: HGNC:2042
Homologene: 47972
1700025G04Rik
Name: RIKEN cDNA 1700025G04 gene
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69399
Homologene: 12776
Alg9
Name: ALG9 alpha-1,2-mannosyltransferase
Synonyms: 8230402H15Rik, B430313H07Rik, Dibd1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102580
Homologene: 6756
Eef1akmt1
Name: EEF1A alpha lysine methyltransferase 1
Synonyms: GtAyu21-96, Ayu21-96, Gt(Ayu21)96Imeg, 2510005D08Rik, N6amt2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68043
VEGA: 14
Homologene: 5952
Gjd3
Name: gap junction protein, delta 3
Synonyms: Gja11, connexin-30.2, cx30.2, connexin 30.2, Gjc1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 353155
Homologene: 17530
Leng1
Name: leukocyte receptor cluster (LRC) member 1
Synonyms: 1500001K17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69757
Homologene: 11520
Spinkl
Name: serine protease inhibitor, Kazal type-like
Synonyms: 9530002K18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 77424
VEGA: 18
Homologene: 128818
Vmn2r29
Name: vomeronasal 2, receptor 29
Synonyms: 6430701C03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76229
Homologene: 113703
Gm49368
Name: predicted gene, 49368
Type: Gene
Species: Mouse
Chromosome: 7
Or6c5b
Name: olfactory receptor family 6 subfamily C member 5B
Synonyms: GA_x6K02T2PULF-11089673-11090600, MOR111-8P, MOR111-14_i, EG546488, Olfr785-ps1, Gm44444, Olfr785
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 546488
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 20,347,361 bp
  • A to G, chromosome 1 at 56,871,784 bp
  • T to C, chromosome 1 at 79,436,895 bp
  • T to G, chromosome 1 at 151,921,090 bp
  • T to A, chromosome 1 at 152,845,430 bp
  • G to T, chromosome 1 at 169,504,528 bp
  • T to A, chromosome 1 at 174,050,700 bp
  • T to A, chromosome 1 at 188,549,913 bp
  • A to G, chromosome 2 at 68,118,552 bp
  • T to A, chromosome 2 at 83,747,875 bp
  • T to C, chromosome 2 at 162,932,862 bp
  • A to G, chromosome 3 at 19,989,098 bp
  • G to T, chromosome 3 at 85,665,898 bp
  • A to G, chromosome 3 at 89,176,500 bp
  • A to G, chromosome 3 at 89,344,192 bp
  • A to G, chromosome 3 at 105,459,617 bp
  • T to G, chromosome 4 at 117,760,719 bp
  • TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT to TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT, chromosome 4 at 156,218,068 bp
  • C to G, chromosome 5 at 3,968,745 bp
  • A to G, chromosome 5 at 31,172,997 bp
  • G to A, chromosome 5 at 32,645,086 bp
  • A to T, chromosome 5 at 96,684,437 bp
  • G to A, chromosome 5 at 105,236,149 bp
  • A to T, chromosome 5 at 120,802,179 bp
  • A to T, chromosome 5 at 146,183,533 bp
  • A to G, chromosome 6 at 71,908,707 bp
  • T to C, chromosome 6 at 92,411,290 bp
  • C to T, chromosome 7 at 3,665,383 bp
  • A to C, chromosome 7 at 7,231,442 bp
  • A to G, chromosome 7 at 56,134,800 bp
  • T to A, chromosome 7 at 67,226,289 bp
  • A to T, chromosome 7 at 86,954,344 bp
  • CGGC to CGGCGGCGGGGGC, chromosome 7 at 97,579,932 bp
  • T to C, chromosome 7 at 100,293,914 bp
  • T to C, chromosome 7 at 104,058,897 bp
  • T to A, chromosome 7 at 128,112,258 bp
  • T to C, chromosome 7 at 135,700,915 bp
  • C to T, chromosome 7 at 137,313,532 bp
  • T to C, chromosome 8 at 40,680,255 bp
  • A to G, chromosome 8 at 69,103,476 bp
  • G to A, chromosome 8 at 72,464,258 bp
  • G to T, chromosome 9 at 34,939,112 bp
  • A to G, chromosome 9 at 50,789,535 bp
  • T to A, chromosome 9 at 110,387,608 bp
  • T to A, chromosome 10 at 19,631,624 bp
  • G to A, chromosome 10 at 60,407,407 bp
  • G to A, chromosome 10 at 90,049,927 bp
  • A to T, chromosome 10 at 117,740,579 bp
  • T to C, chromosome 10 at 129,409,675 bp
  • A to T, chromosome 11 at 63,094,660 bp
  • A to G, chromosome 11 at 98,982,475 bp
  • A to G, chromosome 11 at 103,635,006 bp
  • T to C, chromosome 12 at 78,715,501 bp
  • T to A, chromosome 12 at 101,588,285 bp
  • C to T, chromosome 13 at 45,567,358 bp
  • T to C, chromosome 14 at 51,895,416 bp
  • T to A, chromosome 14 at 57,549,871 bp
  • T to C, chromosome 14 at 65,648,174 bp
  • G to T, chromosome 15 at 10,574,828 bp
  • C to T, chromosome 15 at 10,593,103 bp
  • C to T, chromosome 15 at 27,854,939 bp
  • T to C, chromosome 15 at 78,540,517 bp
  • A to G, chromosome 16 at 57,513,282 bp
  • A to C, chromosome 16 at 94,499,069 bp
  • A to G, chromosome 17 at 3,532,999 bp
  • T to C, chromosome 17 at 20,624,031 bp
  • A to T, chromosome 18 at 7,211,593 bp
  • A to G, chromosome 18 at 44,168,146 bp
  • A to C, chromosome 19 at 20,618,002 bp
  • T to C, chromosome 19 at 39,510,956 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7578 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045663-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.