Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7580Btlr/Mmmh
Stock Number:
045664-MU
Citation ID:
RRID:MMRRC_045664-MU
Other Names:
R7580 (G1)
Major Collection:

Strain Information

Mc1r
Name: melanocortin 1 receptor
Synonyms: e, Mshra, extension recessive yellow, Mcr1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17199
HGNC: HGNC:6929
Homologene: 1789
Xrn1
Name: 5'-3' exoribonuclease 1
Synonyms: mXrn1, Dhm2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 24127
Homologene: 5894
Mtif3
Name: mitochondrial translational initiation factor 3
Synonyms: 2810012L14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76366
Homologene: 49927
Gtse1
Name: G two S phase expressed protein 1
Synonyms: B99, Gtse-1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 29870
VEGA: 15
Homologene: 8489
Sart3
Name: squamous cell carcinoma antigen recognized by T cells 3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 53890
Homologene: 40977
Thoc1
Name: THO complex 1
Synonyms: 3110002N20Rik, NMP-84
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225160
VEGA: 18
Homologene: 38012
Tasor
Name: transcription activation suppressor
Synonyms: 4933409E02Rik, D14Abb1e, MommeD6, Fam208a
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218850
VEGA: 14
Homologene: 9062
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 162,877,044 bp
  • A to C, chromosome 2 at 9,863,132 bp
  • T to C, chromosome 2 at 44,994,532 bp
  • C to G, chromosome 2 at 146,956,249 bp
  • G to A, chromosome 3 at 107,554,468 bp
  • C to T, chromosome 4 at 40,947,836 bp
  • T to A, chromosome 4 at 86,054,064 bp
  • C to A, chromosome 4 at 103,208,133 bp
  • T to C, chromosome 4 at 137,719,982 bp
  • G to A, chromosome 4 at 139,659,745 bp
  • T to A, chromosome 4 at 154,270,744 bp
  • A to G, chromosome 5 at 63,808,281 bp
  • A to G, chromosome 5 at 108,671,869 bp
  • A to T, chromosome 5 at 113,754,379 bp
  • T to G, chromosome 5 at 146,958,947 bp
  • A to T, chromosome 7 at 3,824,612 bp
  • T to C, chromosome 7 at 23,433,749 bp
  • C to T, chromosome 7 at 123,265,198 bp
  • T to C, chromosome 7 at 126,992,311 bp
  • G to A, chromosome 8 at 19,126,410 bp
  • A to G, chromosome 8 at 33,416,633 bp
  • T to A, chromosome 8 at 110,221,677 bp
  • G to A, chromosome 8 at 110,737,636 bp
  • G to T, chromosome 8 at 123,408,167 bp
  • C to T, chromosome 9 at 7,654,143 bp
  • GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT to GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT, chromosome 9 at 88,582,989 bp
  • A to G, chromosome 9 at 96,011,679 bp
  • T to C, chromosome 9 at 110,436,050 bp
  • A to T, chromosome 10 at 86,869,164 bp
  • C to T, chromosome 11 at 56,026,982 bp
  • T to A, chromosome 11 at 67,946,320 bp
  • T to A, chromosome 11 at 83,444,832 bp
  • A to G, chromosome 11 at 86,157,601 bp
  • T to C, chromosome 11 at 106,017,548 bp
  • C to T, chromosome 11 at 119,499,866 bp
  • T to A, chromosome 12 at 55,718,228 bp
  • C to T, chromosome 12 at 100,850,164 bp
  • G to A, chromosome 13 at 3,574,752 bp
  • T to A, chromosome 13 at 38,022,724 bp
  • T to A, chromosome 13 at 60,845,226 bp
  • C to T, chromosome 14 at 22,019,857 bp
  • A to G, chromosome 14 at 27,466,286 bp
  • A to G, chromosome 14 at 68,565,531 bp
  • A to T, chromosome 15 at 58,558,396 bp
  • T to C, chromosome 15 at 73,556,447 bp
  • G to A, chromosome 15 at 85,862,231 bp
  • A to C, chromosome 15 at 88,933,929 bp
  • C to A, chromosome 16 at 37,618,879 bp
  • G to A, chromosome 16 at 90,229,852 bp
  • A to G, chromosome 17 at 30,775,103 bp
  • T to C, chromosome 17 at 38,209,043 bp
  • A to T, chromosome 18 at 9,986,343 bp
  • A to T, chromosome 18 at 20,050,073 bp
  • C to T, chromosome 18 at 67,237,417 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7580 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045664-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.